ID: 1064133463

View in Genome Browser
Species Human (GRCh38)
Location 10:12730440-12730462
Sequence GCCTATTCAAACTCTTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 182}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064133463_1064133468 7 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133468 10:12730470-12730492 TATATTTAGGATAAAAGCCTGGG No data
1064133463_1064133465 -6 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133465 10:12730457-12730479 ATAGGCCGTTGGATATATTTAGG No data
1064133463_1064133470 24 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133470 10:12730487-12730509 CCTGGGCTATAGATACACATTGG No data
1064133463_1064133471 25 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133471 10:12730488-12730510 CTGGGCTATAGATACACATTGGG No data
1064133463_1064133473 27 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133473 10:12730490-12730512 GGGCTATAGATACACATTGGGGG No data
1064133463_1064133467 6 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133467 10:12730469-12730491 ATATATTTAGGATAAAAGCCTGG No data
1064133463_1064133472 26 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133472 10:12730489-12730511 TGGGCTATAGATACACATTGGGG No data
1064133463_1064133474 30 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133474 10:12730493-12730515 CTATAGATACACATTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064133463 Original CRISPR GCCTATTCAAACTCTTCACT TGG (reversed) Intronic
900207442 1:1437641-1437663 GTCTATGCACACTCTTCACTGGG + Intronic
901273266 1:7970346-7970368 GTCTACTCAAAGTCTTAACTGGG + Intronic
905055682 1:35091510-35091532 GCCTATTAAATATCTCCACTTGG - Intronic
905473723 1:38211401-38211423 GCCCATTCAAACTCTCCCCTTGG + Intergenic
907573818 1:55507688-55507710 GCCTCTTCAAGGTCTTCTCTGGG - Intergenic
908690838 1:66778357-66778379 GTCTATTCAAAAACCTCACTGGG - Exonic
910724556 1:90324882-90324904 CTCTTTCCAAACTCTTCACTTGG - Intergenic
911466112 1:98254556-98254578 CCCTATTCAAACAACTCACTTGG + Intergenic
913026617 1:114849573-114849595 GCCTATTCAAGATTTTAACTTGG + Intergenic
913488274 1:119354083-119354105 GCCTAGTCAAACTTTTGGCTGGG - Intergenic
914199277 1:145470418-145470440 GCGTCCTCAAACTTTTCACTAGG - Intergenic
915198310 1:154207153-154207175 GCTTCTTAAAAATCTTCACTTGG - Exonic
916486363 1:165263250-165263272 ACCTACTCAACATCTTCACTTGG + Intronic
916644094 1:166764859-166764881 GCCTACTTAAAATTTTCACTTGG - Intergenic
917157673 1:172021729-172021751 AGCTTTTCAAAGTCTTCACTAGG + Intronic
917716641 1:177745045-177745067 TCCTATTCAATATCTCCACTGGG + Intergenic
917905623 1:179584947-179584969 ACCTATTCCAGCTATTCACTTGG - Intergenic
919071641 1:192763141-192763163 GCCTACTCAACCTCCTCATTTGG + Intergenic
920652032 1:207845092-207845114 GTCTTGTCAAACTCTTCATTTGG - Intergenic
921271718 1:213475901-213475923 GTCTATTGAAACTGTACACTTGG + Intergenic
921741245 1:218687578-218687600 TCCTACTCAAAATCTCCACTAGG + Intergenic
921819825 1:219604541-219604563 GACTATACAAACTCTTGGCTGGG - Intergenic
921846168 1:219884683-219884705 GCCTACTTAAAATCTCCACTTGG + Intronic
922732254 1:227955319-227955341 GTCTTTTCATACTCTTCACATGG + Intergenic
1063138510 10:3237139-3237161 CCCTTTTTAAATTCTTCACTTGG - Intergenic
1064133463 10:12730440-12730462 GCCTATTCAAACTCTTCACTTGG - Intronic
1065119621 10:22515847-22515869 GGCTATTCAACCTCTTCACTTGG - Intergenic
1065516101 10:26525880-26525902 GCCTGTTCCAATTCTTCTCTGGG + Intronic
1067219703 10:44335210-44335232 GCATTTGCAAACTCTTCGCTTGG + Intergenic
1068079206 10:52298668-52298690 CCCTAGTCAAACTCTGTACTAGG + Intergenic
1069347207 10:67483996-67484018 GCCTATTCAAATTCTTTTTTTGG - Intronic
1069381205 10:67844572-67844594 GCCAATTAAAACTCTTTTCTTGG + Intergenic
1069852843 10:71421401-71421423 GCCGAGTAAAATTCTTCACTGGG + Intronic
1071158816 10:82722635-82722657 GCTTATTAAATCACTTCACTTGG + Intronic
1074567309 10:114592286-114592308 GCCTTGACAAGCTCTTCACTTGG - Intronic
1074616978 10:115079283-115079305 GCCTATACGATATCTTCACTTGG + Intergenic
1076126663 10:127979373-127979395 GCCTAATGGAAGTCTTCACTTGG + Intronic
1076998884 11:312390-312412 GCCTACACAAACTCCTCACAAGG - Intronic
1078703541 11:13715438-13715460 CCCTATACAAACTCATCCCTAGG - Intronic
1079289423 11:19173872-19173894 CTCTATTCAGACTCTTCTCTAGG - Intronic
1080109124 11:28545985-28546007 GCCTGTTAAACCTCTTCCCTAGG - Intergenic
1081175094 11:39918170-39918192 GCCTAGTCAACCTCTCCCCTTGG + Intergenic
1082750683 11:57012146-57012168 GCTTTTTCATCCTCTTCACTGGG + Intergenic
1082857814 11:57824731-57824753 GGCTATTCAAGCTCATCTCTGGG + Intergenic
1087248508 11:95869767-95869789 GCATCTTGAAACCCTTCACTAGG - Intronic
1088299841 11:108345161-108345183 GCCCATTCAGCATCTTCACTTGG - Intronic
1089219709 11:116860354-116860376 GCCAATTCAGACTCTTCTCAAGG + Intronic
1091188778 11:133671734-133671756 GTCTATTCAGTCTCTCCACTTGG - Intergenic
1093042046 12:14392392-14392414 GACTCTTCAAAGTCTTCACTTGG - Intronic
1093334582 12:17886956-17886978 GGTTCTTCAAAATCTTCACTTGG + Intergenic
1095710423 12:45282227-45282249 GCCTATGCAACATCTTGACTTGG - Intronic
1097726587 12:63081859-63081881 GCTTATTCAGTCTCATCACTTGG - Intergenic
1099873542 12:88376953-88376975 TCTTCTTCAGACTCTTCACTAGG + Intergenic
1100773325 12:97948110-97948132 GCCTATTCATCATCTGCACTGGG - Intergenic
1101242177 12:102849365-102849387 GCCTATTCAACATCTCCCCTTGG - Intronic
1102345550 12:112158889-112158911 GCCTATTTAGACTCCTCTCTGGG - Intergenic
1103840591 12:123860872-123860894 ACCCATGCAAACTCTTCACTGGG - Intronic
1107239372 13:38213521-38213543 GCCTATTCATAATCTTCTCTTGG - Intergenic
1112851776 13:103714906-103714928 GCCTACTCAATGACTTCACTTGG + Intergenic
1113578645 13:111412515-111412537 GGCTCTACAAACTCTGCACTTGG + Intergenic
1114195142 14:20470143-20470165 GCCTTTGAAAACTCTTCTCTCGG + Intronic
1115075018 14:29378365-29378387 GCCTATGCAAACTGATTACTCGG - Intergenic
1115875500 14:37857286-37857308 GCCTAGTTAAGCTCTTTACTTGG - Intronic
1117241131 14:53834929-53834951 GCCTACTCAAAATCTTCAGTAGG + Intergenic
1117397727 14:55327698-55327720 GTCTATTCGAAATCTCCACTTGG - Intronic
1121877944 14:97471155-97471177 GCTTATTCAATATCTCCACTGGG - Intergenic
1125297115 15:38215353-38215375 AGCTATTCAAACTGCTCACTAGG - Intergenic
1126529087 15:49691672-49691694 GTCTATTCAAAATCTCCACAAGG - Intergenic
1126930877 15:53649612-53649634 GTCTATTCAAACCCTTGGCTTGG - Intronic
1127348399 15:58125315-58125337 GCCTATTTAAACTGTTCCATAGG + Intronic
1129712392 15:77826967-77826989 CCCTTTCCAAACTCTGCACTGGG + Intergenic
1131065115 15:89429705-89429727 GCCTGCTCAGACTCCTCACTTGG + Intergenic
1132025841 15:98403808-98403830 GCTTTTTCAAACTCCTTACTTGG + Intergenic
1140026982 16:71299629-71299651 GCCTATTCAACATCTCCACTGGG + Intergenic
1144562458 17:16332203-16332225 GCCTATTAAATCTCTACAGTAGG - Intronic
1146145770 17:30414880-30414902 GCCTATTCAAAATCTTTACTTGG - Intronic
1146328694 17:31909559-31909581 GCCTACTCAACATCTGCACTTGG + Intergenic
1146784140 17:35703875-35703897 GCCTACTTAATATCTTCACTTGG - Intronic
1147038679 17:37700756-37700778 TCCTCTTCAAACCCTTCCCTGGG + Intronic
1150523241 17:65891691-65891713 TGCAATTCAAACTCTTCACCAGG + Intronic
1153737067 18:8082311-8082333 GACTATTCATACAATTCACTGGG - Intronic
1155058340 18:22205168-22205190 GCATATTCCAAGTCTGCACTAGG + Intergenic
1156069438 18:33188321-33188343 GCTTATTCAAACTCTACTCTGGG + Intronic
1156337599 18:36185134-36185156 GCCTATTCCAATCCATCACTAGG + Intergenic
1159739446 18:72147853-72147875 CTCTATTTAAACTCTTCAATAGG + Intergenic
1164127620 19:22332905-22332927 GGCAATTCAAACTGTTGACTAGG + Intergenic
1164715665 19:30388585-30388607 GCTTCTTCAACTTCTTCACTTGG + Intronic
925279489 2:2672766-2672788 GCCTTCTACAACTCTTCACTAGG - Intergenic
926848383 2:17167463-17167485 GGCTATTCAAACTCTTTTTTTGG - Intergenic
927407859 2:22792507-22792529 TCCTGTTCACACTCTTCATTGGG + Intergenic
928467858 2:31539675-31539697 GAATATTCCAACTCTCCACTAGG - Intronic
928765750 2:34643401-34643423 GCCAATAGAAACTCTTAACTTGG + Intergenic
929709802 2:44255396-44255418 GTCTATTCAAATTTTTAACTGGG - Intergenic
930311824 2:49751701-49751723 TCATATTCAATCTCTGCACTTGG - Intergenic
930695506 2:54407539-54407561 GCCAACTCAACATCTTCACTTGG - Intergenic
931385140 2:61791808-61791830 GCCTGTTTAAACTCTTGACTTGG - Intergenic
931387336 2:61809460-61809482 GCCAGTTCAAAGTCTCCACTTGG + Intergenic
932134437 2:69215821-69215843 TCTTCTTCAAATTCTTCACTTGG + Intronic
933491194 2:82986947-82986969 GCCAATTCCACCTCTTCACCTGG - Intergenic
934017250 2:87900607-87900629 GCCTATTCAAAATCTCCACTTGG + Intergenic
936792983 2:116171811-116171833 GCCTTTTCTAACTCTCCACAAGG + Intergenic
937710322 2:124973499-124973521 TGATATTCAAATTCTTCACTTGG + Intergenic
939798682 2:146679887-146679909 GCTCATTAAAATTCTTCACTTGG + Intergenic
940365181 2:152840304-152840326 GCCAATTAAACATCTTCACTGGG + Intergenic
940376619 2:152965475-152965497 GCCTAATCAAACTCTAAAATGGG - Intergenic
942111113 2:172683562-172683584 ATCTATTCAACATCTTCACTTGG - Intergenic
943373792 2:187050122-187050144 GGCTATTCACACTCTTCTTTTGG + Intergenic
943430159 2:187789515-187789537 GTCTTTTCCAAATCTTCACTTGG - Intergenic
945657746 2:212645697-212645719 GCATATTCAAAATTTTCAGTAGG - Intergenic
946732223 2:222720692-222720714 CCCTACTCACAGTCTTCACTGGG - Intergenic
946855838 2:223948909-223948931 GCCTACTCAGCCCCTTCACTTGG - Intergenic
947218690 2:227772254-227772276 GCCTATTGAGACCCTTCTCTAGG + Intergenic
1170374142 20:15681414-15681436 GCCTATTCAAAGACTTCAGCAGG - Intronic
1171136327 20:22698004-22698026 GCCTACTCAACCTTTCCACTTGG + Intergenic
1172750624 20:37248479-37248501 GCCTACTCAACTTCCTCACTTGG + Intergenic
1177735805 21:25087206-25087228 CCCTATTCAAACACTTTACCTGG + Intergenic
1178055801 21:28797164-28797186 GCAGACTCTAACTCTTCACTGGG + Intergenic
1184999637 22:48237507-48237529 GCCCATTCCCACTCTTCCCTAGG - Intergenic
949615484 3:5749397-5749419 GGCTATTCAAACTTTTGAATTGG + Intergenic
949719674 3:6974314-6974336 GTCTATTCAACATCTCCACTAGG - Intronic
951468984 3:23035328-23035350 GCATGTTCAAACCCATCACTAGG - Intergenic
954196721 3:49001524-49001546 GCCTCTTCATACTCTTCAGTAGG - Exonic
955588021 3:60502458-60502480 ATCTAATCAAACACTTCACTCGG + Intronic
958914015 3:100027389-100027411 GCCAAATAAAACTCTTCAATAGG + Intronic
964469572 3:157038402-157038424 GCCTAGTCAACATCTCCACTTGG - Intronic
969560751 4:7946261-7946283 GCCAATTAAACCTCTTCTCTTGG - Intergenic
970323466 4:14898688-14898710 GCCTACTCAATATTTTCACTTGG - Intergenic
970488139 4:16544777-16544799 GCCTCTTCAATGTTTTCACTTGG - Intronic
970786642 4:19805149-19805171 GGCTTTTCACTCTCTTCACTCGG + Intergenic
975315805 4:72952052-72952074 GCATATTCAAAGTATTCACAGGG - Intergenic
975383247 4:73726846-73726868 GCCTCTCCAGACTCTTCTCTGGG - Intergenic
976114558 4:81713151-81713173 GCCTATTCCAACAGTTCAATTGG + Intronic
978608876 4:110514509-110514531 GCCTATTCTAATTATTCACATGG + Intronic
978763853 4:112384241-112384263 GTTTTTTCAAGCTCTTCACTTGG - Intronic
978765019 4:112395993-112396015 ATCCATTCAAACTCTTCATTTGG + Intronic
979433272 4:120658603-120658625 GCCTGTTCTGGCTCTTCACTGGG - Intergenic
981066811 4:140494563-140494585 GCCTATTCAACACTTTCACTGGG + Intronic
983599564 4:169510888-169510910 GCCTCTTCAAAGCCTTCTCTAGG + Intronic
987297226 5:16564622-16564644 GCCTATGCCAGCTCTTCCCTGGG + Intronic
989490761 5:42049692-42049714 GCCCATTAAAAATTTTCACTAGG + Intergenic
990452611 5:55950210-55950232 GCCTATTCAAACTCTGTCCATGG - Intronic
991030157 5:62074165-62074187 GCCTCTTCAGACTGTTCCCTGGG - Intergenic
992064791 5:73096644-73096666 GCCTCTACAAACACTTCCCTAGG - Intergenic
996947847 5:129092199-129092221 GCCTATTCGACATCTCCACTTGG - Intergenic
997407922 5:133667014-133667036 GCCTATTTAATATCTTCACTTGG + Intergenic
997478818 5:134166902-134166924 ACCTATGCAAACACTTCCCTAGG - Intronic
997892852 5:137690392-137690414 ACCTCTTCAAAGGCTTCACTGGG + Intronic
998366251 5:141634300-141634322 TCCTCTTCATACTCTGCACTTGG + Intronic
998747050 5:145272924-145272946 GCCTGTTCAAACTCTCCAGAAGG - Intergenic
1000259768 5:159576391-159576413 GCTTTTTCCATCTCTTCACTTGG - Intergenic
1000618434 5:163456114-163456136 GCCTATTCAACATCTCCACCTGG - Intronic
1000822649 5:166003732-166003754 AAATATTCAAAATCTTCACTGGG - Intergenic
1004081814 6:12402350-12402372 GTCTATTCACACTTTCCACTAGG + Intergenic
1004785787 6:18965889-18965911 GCCTATTCAACATCTTCATTTGG - Intergenic
1004889275 6:20083446-20083468 GCCTACTCTAACTCTCCTCTTGG + Intergenic
1005588348 6:27298999-27299021 GCCTTTTTAAACTTTTCACCCGG + Intronic
1005939491 6:30550243-30550265 GCCTATTCAACATCTCCACTAGG + Intronic
1011844627 6:91548142-91548164 GCCTACTCAATAACTTCACTTGG - Intergenic
1013105881 6:107026390-107026412 GCCTACTTAACATCTTCACTTGG - Intergenic
1016276584 6:142360252-142360274 ACCTACTCAATATCTTCACTTGG - Intronic
1017317440 6:153048125-153048147 ACCTACTCAATATCTTCACTTGG + Intronic
1022261373 7:28708134-28708156 GGCTGAGCAAACTCTTCACTGGG - Intronic
1023998738 7:45177629-45177651 TCCTATTCACACTCTGCTCTTGG + Intronic
1026655379 7:72252080-72252102 GCCTATTCAGAATCTCCACCTGG + Intronic
1026759977 7:73119418-73119440 GCCAATTAAAACTCTTTTCTTGG - Intergenic
1027036319 7:74928230-74928252 GCCAATTAAAACTCTTTTCTTGG - Intergenic
1027087244 7:75273234-75273256 GCCAATTAAAACTCTTTTCTTGG + Intergenic
1028671983 7:93411500-93411522 GCCTACTCAGACTCATAACTGGG - Intergenic
1028833862 7:95352483-95352505 GCCTCATCCAACCCTTCACTTGG - Intergenic
1029131801 7:98337104-98337126 GCCAACTAAAACTCTTCACGGGG + Intronic
1029364427 7:100107806-100107828 GCCTCTTCCAGCTCTTGACTTGG + Intronic
1029393550 7:100291208-100291230 GCCAATTAAAACTCTTTTCTTGG + Intergenic
1031674835 7:124596862-124596884 CCCTATTCACAATCTCCACTTGG + Intergenic
1032758252 7:134912728-134912750 ACCTACTGAAATTCTTCACTGGG - Intronic
1032892258 7:136209954-136209976 GTCTTTTCATCCTCTTCACTTGG - Intergenic
1039271852 8:35890810-35890832 GCCTTCTCTGACTCTTCACTTGG - Intergenic
1041232425 8:55767468-55767490 GCCTACTTAATGTCTTCACTTGG - Intronic
1041622996 8:59995147-59995169 ACCTACTCAACATCTTCACTTGG + Intergenic
1043775155 8:84257782-84257804 GCCTATTTTAAATTTTCACTGGG - Intronic
1045635249 8:104178567-104178589 GGCTATTCAAACACTAGACTAGG - Intronic
1046396172 8:113642739-113642761 GCATAGTCAATATCTTCACTAGG + Intergenic
1046705063 8:117440528-117440550 GCCTAATCAACATCTCCACTAGG + Intergenic
1052230798 9:26150093-26150115 GCTTATTCTTACGCTTCACTTGG + Intergenic
1053089673 9:35263425-35263447 GCATACTCAAATTCCTCACTTGG + Intronic
1056721591 9:89076612-89076634 GCATGTTCAAACACTGCACTAGG - Intronic
1057085988 9:92210851-92210873 TCATATTCAAAGTCTTCACGGGG + Exonic
1057846012 9:98524487-98524509 GCCTATTCAACCTCTCCATCTGG + Intronic
1187406174 X:19006181-19006203 ACCTTTTCAAACTCTTGAGTGGG - Intronic
1188900697 X:35729568-35729590 GGCTATTCAAACTCTTTTTTTGG + Intergenic
1189948956 X:46208794-46208816 GCCTATTCAAATCCATCATTGGG + Intergenic
1190815050 X:53922527-53922549 GCCTATTCAATATTTTCACTTGG - Intergenic
1192551116 X:72054345-72054367 ACATTTTCAAACTCTTCCCTGGG + Intergenic
1192629456 X:72764954-72764976 GTCTTTTCACACTCTTAACTTGG - Intergenic
1192652254 X:72955860-72955882 GTCTTTTCACACTCTTAACTTGG + Intergenic
1195258169 X:103108569-103108591 GCCCATTTAAAATCTTCAATTGG - Intergenic
1198004926 X:132483255-132483277 ACGAATACAAACTCTTCACTTGG + Intronic
1199127233 X:144137938-144137960 GCCTATTCAAAATCTCCACTTGG - Intergenic
1199246536 X:145611759-145611781 GCCTATTCAATTTCTCCCCTTGG + Intergenic
1199473199 X:148218046-148218068 GCTTCTTCACACTCTTCCCTGGG - Intergenic
1200334768 X:155338294-155338316 GGCTATTCAGACTCTTCTTTCGG + Intergenic
1200351698 X:155502927-155502949 GGCTATTCAGACTCTTCTTTCGG - Intronic