ID: 1064133466

View in Genome Browser
Species Human (GRCh38)
Location 10:12730462-12730484
Sequence TTTATCCTAAATATATCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 316}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064133466_1064133478 21 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133478 10:12730506-12730528 TTGGGGGTGGAGGGGACCATTGG No data
1064133466_1064133473 5 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133473 10:12730490-12730512 GGGCTATAGATACACATTGGGGG No data
1064133466_1064133470 2 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133470 10:12730487-12730509 CCTGGGCTATAGATACACATTGG No data
1064133466_1064133475 11 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133475 10:12730496-12730518 TAGATACACATTGGGGGTGGAGG No data
1064133466_1064133472 4 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133472 10:12730489-12730511 TGGGCTATAGATACACATTGGGG No data
1064133466_1064133474 8 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133474 10:12730493-12730515 CTATAGATACACATTGGGGGTGG No data
1064133466_1064133476 12 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133476 10:12730497-12730519 AGATACACATTGGGGGTGGAGGG No data
1064133466_1064133477 13 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133477 10:12730498-12730520 GATACACATTGGGGGTGGAGGGG No data
1064133466_1064133471 3 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133471 10:12730488-12730510 CTGGGCTATAGATACACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064133466 Original CRISPR TTTATCCTAAATATATCCAA CGG (reversed) Intronic
902825011 1:18967163-18967185 TTTGTCCTTAATATATCCCCAGG - Intergenic
906571540 1:46846022-46846044 TTTCTCCTGCATACATCCAAAGG - Intergenic
912190383 1:107332025-107332047 TTTATTCTAAATGTTTCCACTGG - Intronic
913563107 1:120043115-120043137 TTAATCCTAAATATATTGTATGG - Intronic
913635016 1:120750475-120750497 TTAATCCTAAATATATTCTGTGG + Intergenic
914283703 1:146202473-146202495 TTAATCCTAAATATATTCTATGG - Intronic
914427825 1:147594875-147594897 TTTATTCCCAATTTATCCAAAGG - Intronic
914544734 1:148653209-148653231 TTAATCCTAAATATATTCTATGG - Intronic
914621893 1:149417796-149417818 TTAATCCTAAATATATTCTATGG + Intergenic
916900522 1:169217733-169217755 GTTTTCCTAAATATATCAAAGGG - Intronic
916999072 1:170336074-170336096 TTTTTACTAAATATATCCAATGG - Intergenic
917354641 1:174113796-174113818 TATTTCCTACATATAACCAAAGG + Intergenic
917829806 1:178869423-178869445 CTTTTCTTAAATATATCCAGGGG - Intronic
919256670 1:195134362-195134384 TTTATATTAAATATATTAAATGG + Intergenic
919615005 1:199795800-199795822 ATTATCTTAAATGTATCCAGTGG - Intergenic
920603624 1:207356377-207356399 TTTTTTCTCAATATATTCAAAGG + Intronic
921233995 1:213105743-213105765 TTTATCCTAAAGATCTGCATAGG - Intronic
921752655 1:218815059-218815081 TTTATACTAAATAAATACCATGG + Intergenic
922017275 1:221663142-221663164 GCTATCATAAATATGTCCAAAGG - Intergenic
922281416 1:224128537-224128559 TTAATCCTAATGATATCCTATGG + Intronic
922359279 1:224806278-224806300 TTTATTAAAAATATATCAAATGG + Intergenic
922398170 1:225224013-225224035 TGTATCCAAGATATTTCCAAGGG - Intronic
922438512 1:225630111-225630133 TTTTTTCTAAATATTTCAAAAGG - Intronic
923355937 1:233155723-233155745 TTTATCTTAAAACTTTCCAAAGG - Intronic
924313257 1:242768845-242768867 GATATATTAAATATATCCAAAGG + Intergenic
924914623 1:248552562-248552584 TTTGTTATAAATATATCTAAAGG + Intergenic
1062987336 10:1780736-1780758 ATTCTCCTAAATATTTCAAATGG + Intergenic
1063030339 10:2228257-2228279 TTTAGCACATATATATCCAAAGG + Intergenic
1064065874 10:12181098-12181120 TTTTTCCTAAATATTTTCAATGG - Intronic
1064133466 10:12730462-12730484 TTTATCCTAAATATATCCAACGG - Intronic
1066033330 10:31452678-31452700 TTTATCCTAAATACAGTCACTGG - Intronic
1066498945 10:35971380-35971402 TTTAACCTAAAAATATAAAAAGG + Intergenic
1068468365 10:57426448-57426470 TTTATTCTCTATTTATCCAATGG + Intergenic
1068586858 10:58809590-58809612 TTTATCCTGAAGAAAACCAAGGG + Intronic
1071589591 10:86860191-86860213 TTTATCCTATAAATATCTTATGG - Intronic
1072363244 10:94681634-94681656 TATACCTTAAATATATACAATGG + Intergenic
1074713201 10:116194431-116194453 TTTATCCTGAAGAAATCGAAAGG + Intronic
1074959095 10:118423133-118423155 GTTATCCACAATATATTCAAAGG + Intergenic
1075446000 10:122513491-122513513 TTTAGCCTAAAAATCTCAAAAGG + Intronic
1078590196 11:12634110-12634132 TATATCCTAAATATATTAAATGG - Intergenic
1078664188 11:13310803-13310825 TTTATCCAAAATAACTTCAATGG - Intronic
1079662770 11:23061690-23061712 TTAATCATAAATATTTGCAAAGG - Intergenic
1080470707 11:32542869-32542891 ATTCTCATAAGTATATCCAATGG - Intergenic
1080837418 11:35952586-35952608 TCTATCATTAATATATTCAAAGG - Intronic
1081098540 11:38970763-38970785 ATCAACCTAAATATTTCCAATGG - Intergenic
1081388347 11:42499841-42499863 TTTATCCTAAACATTTGCATAGG + Intergenic
1085692703 11:78676835-78676857 TTTAAACTAAATATATACAGTGG - Intronic
1086143875 11:83529195-83529217 TTTATGCTGAATTTATCCCAAGG + Intronic
1086901915 11:92377262-92377284 GTTATAATAAAAATATCCAATGG + Intronic
1087004075 11:93451554-93451576 CTAATCCTAAATATATCCGTTGG + Intergenic
1087468349 11:98539387-98539409 TTTACCATTAATATATACAAAGG + Intergenic
1091524945 12:1290374-1290396 TTTATTGTAAACATTTCCAAAGG + Intronic
1092605570 12:10114893-10114915 TTTATCCTATATACTTTCAATGG + Intergenic
1092934952 12:13352134-13352156 TTTATCCCACATATATCATAGGG - Intergenic
1093556804 12:20486000-20486022 TTTCTCCTAATAAAATCCAAGGG + Intronic
1095175752 12:39090370-39090392 TTATTCCTAACAATATCCAACGG + Intergenic
1095221421 12:39620559-39620581 TTTATCCTATTTATTTACAAGGG - Intergenic
1098285501 12:68903339-68903361 CTTATGTTCAATATATCCAAAGG + Intronic
1098513768 12:71349943-71349965 TTTATTCTTAATTTATCCACTGG + Intronic
1098710061 12:73746200-73746222 TTTTTCCTATATGTATGCAAAGG + Intergenic
1100279270 12:93102746-93102768 GTTATGCTAAAAATTTCCAAAGG - Intergenic
1100322871 12:93513518-93513540 TTTATTCAAAGTATATCTAATGG + Exonic
1100625735 12:96329590-96329612 TAGATCCTACATATATCCAATGG + Intronic
1101282986 12:103278785-103278807 TTCCTCCAAAATAAATCCAATGG + Intronic
1101611984 12:106301403-106301425 TTTATCCTCAAAATAACCCAAGG + Intronic
1104188354 12:126454264-126454286 TTTAGCCTAAATATTTCCCCTGG - Intergenic
1107821091 13:44286375-44286397 TTTATTCCAAAGATATCCATTGG - Intergenic
1108534950 13:51366139-51366161 TATATTCAAAATATATTCAAGGG + Intronic
1109414382 13:62018084-62018106 TATATAGTAAATATATCAAAAGG + Intergenic
1109531673 13:63657281-63657303 TTTATACTAAATATATTGACAGG + Intergenic
1109804713 13:67423489-67423511 TTTATCCAAAATCTATGCTAGGG + Intergenic
1110831118 13:80031933-80031955 TTTAACCTAAATCTTTCCCAGGG - Intergenic
1111204810 13:84992591-84992613 TTTACCCTAACTCTGTCCAATGG + Intergenic
1111349993 13:87015537-87015559 TTTATACCAACTATATCTAATGG + Intergenic
1111455755 13:88481660-88481682 TTTATCCAAAGTAGATACAAGGG - Intergenic
1112035765 13:95495337-95495359 TATTTGCTAAATATATGCAAAGG - Intronic
1112036681 13:95503140-95503162 TATATATTAAATATCTCCAATGG - Intronic
1112454096 13:99542400-99542422 ATTATTTTAAATATATCAAAAGG - Intronic
1112792935 13:103023352-103023374 AATATGCTAAATATATGCAAAGG - Intergenic
1114791212 14:25660477-25660499 TTGATCCTAAACTTAGCCAAGGG + Intergenic
1114974720 14:28080783-28080805 TTTATCCAAAATATAAATAATGG + Intergenic
1116014965 14:39395371-39395393 TTTAACTTAAAAATATGCAAAGG + Intergenic
1116278541 14:42870090-42870112 ATTATCCTAAACAAATCAAATGG + Intergenic
1116549028 14:46210603-46210625 TTTATCATAAGGATATCCTATGG + Intergenic
1116719018 14:48469192-48469214 GCTATCCTAAATTTATCCAAGGG - Intergenic
1118245104 14:64102537-64102559 TATACCATAAATATATACAATGG - Intronic
1118394261 14:65322332-65322354 TTTGTCTTAAATATATCTTATGG + Intergenic
1118506535 14:66419460-66419482 TATTTCCTTTATATATCCAAAGG + Intergenic
1118763197 14:68893149-68893171 CTTAACCTAAATGTAGCCAATGG + Intronic
1119931248 14:78549601-78549623 TTTATTCAAAAAATATCCACTGG - Intronic
1120134134 14:80845012-80845034 TTTACCCTAAACCTAGCCAAGGG + Intronic
1120849695 14:89158750-89158772 TTTCTCTTAAATGTATCCGAGGG + Exonic
1123188745 14:106546597-106546619 TTTTACCTAAATGTGTCCAAAGG - Intergenic
1123832313 15:24153055-24153077 TTTAGCCTAAATATTTCCCCTGG - Intergenic
1123838034 15:24216210-24216232 TTTAGCCTAAATATTTCCCCTGG + Intergenic
1125118379 15:36122630-36122652 TTTAGCCTTAATTTATCCATTGG + Intergenic
1126259776 15:46675436-46675458 ATTCTCCTAAATGTTTCCAAAGG - Intergenic
1127594468 15:60465084-60465106 GTGAACCTAAATATATCCAAAGG - Intronic
1127703221 15:61522544-61522566 TTTTACCTAAATATATGCAGAGG + Intergenic
1128880911 15:71242058-71242080 TTAATCCTGAAAATATTCAAGGG - Intronic
1130264366 15:82386113-82386135 GTTTACCTAAAAATATCCAAAGG + Intergenic
1130276650 15:82481488-82481510 GTTTACCTAAAAATATCCAAAGG - Intergenic
1130469015 15:84208875-84208897 GTTTACCTAAAAATATCCAAAGG - Intergenic
1130475001 15:84257128-84257150 GTTTACCTAAAAATATCCAAAGG + Intergenic
1130476505 15:84323425-84323447 GTTTACCTAAAAATATCCAAAGG - Intergenic
1130482416 15:84371181-84371203 GTTTACCTAAAAATATCCAAAGG + Intergenic
1130495260 15:84464705-84464727 GTTTACCTAAAAATATCCAAAGG + Intergenic
1130507627 15:84560823-84560845 GTTTACCTAAAAATATCCAAAGG - Intergenic
1130591309 15:85213471-85213493 GTTTACCTAAAAATATCCAAAGG - Intergenic
1131010296 15:89011901-89011923 TTTAGCCTAAATATATGCCCTGG + Intergenic
1131450292 15:92533591-92533613 TTTTTCCTAAATATTTAGAATGG + Intergenic
1131640269 15:94284856-94284878 TTTATCCTAAATAGTTGTAAAGG - Intronic
1131655638 15:94455309-94455331 TTCATCCCAAATATTTTCAAAGG - Intronic
1132427970 15:101736095-101736117 GTTTACCTAAAAATATCCAAAGG - Intergenic
1135383822 16:22018134-22018156 TTTTTGCTCAATATATACAACGG - Intronic
1135752733 16:25069839-25069861 TTTCTCCTAAATATCCCAAAAGG - Intergenic
1136869401 16:33791695-33791717 GTTTACCTAAATATGTCCAAAGG + Intergenic
1141534141 16:84667264-84667286 TTTAACCTCAATCAATCCAAAGG - Intronic
1203102772 16_KI270728v1_random:1324373-1324395 GTTTACCTAAATATGTCCAAAGG - Intergenic
1145284291 17:21493746-21493768 TCCAACCTAAATATCTCCAAAGG + Intergenic
1145393160 17:22471750-22471772 TCTAACCTAAATCTCTCCAAAGG - Intergenic
1145918209 17:28589417-28589439 TTACTCTTAAATATATCCAGTGG + Intronic
1147915840 17:43885270-43885292 TTTATCCCAAATTTGTCCAGTGG + Intronic
1149188344 17:54028952-54028974 TTTATTCTAAATATATTTGAAGG + Intergenic
1150459726 17:65339198-65339220 TTTAGCCTAACTAACTCCAAAGG - Intergenic
1150846896 17:68668088-68668110 TTTATCCAAAAAAAATCCAAGGG - Intergenic
1153613702 18:6913410-6913432 TTTATCCCAGATATATACATTGG + Exonic
1154219547 18:12440287-12440309 TTCATCTTAAATATCTCAAAGGG - Intergenic
1155064867 18:22259764-22259786 TTTATCCTGAGTAGATCAAAAGG - Intergenic
1155683835 18:28522079-28522101 TTTATCTGAAGTATATCCAAGGG - Intergenic
1155835838 18:30582729-30582751 TTTCTACTAAATATATCCCTTGG + Intergenic
1156092736 18:33490961-33490983 ATTATCCTGAATATATCAGATGG - Intergenic
1156781935 18:40860740-40860762 TTTATTTTGAATTTATCCAAGGG - Intergenic
1158305107 18:56096681-56096703 TTTATCCTAAATATATTCCATGG + Intergenic
1159487934 18:69090465-69090487 TTTGTCCTCAAAATAACCAATGG - Intergenic
1159734002 18:72071392-72071414 ATTCTCCTAAATGTTTCCAAAGG - Intergenic
1163987448 19:20967087-20967109 TTTATCCTGAATATATCACTGGG + Intergenic
1167408121 19:49327606-49327628 TTTTTCATAACTATATCCCAGGG - Intergenic
925486112 2:4333292-4333314 TTTATCCAAAAGAATTCCAAGGG - Intergenic
927286711 2:21364197-21364219 TTTCTGCTAAATATATAGAAAGG - Intergenic
928793440 2:34986872-34986894 TGTCTCCAATATATATCCAAAGG - Intergenic
930375064 2:50554675-50554697 TTAATTCTAAATTTATCCATAGG + Intronic
930377479 2:50586201-50586223 TTCTTCCTCAATATAGCCAAAGG + Intronic
930994180 2:57696669-57696691 TTTAGCATAAATATAAGCAAGGG + Intergenic
932099022 2:68879725-68879747 TTAAGCTTAAATATAACCAAGGG + Intergenic
932240152 2:70149872-70149894 TTTTTCCTAATTATATCTCATGG - Exonic
933396818 2:81742466-81742488 TTAAACCTGAATATATACAAAGG + Intergenic
933479321 2:82835161-82835183 TTTTTCTTTAATATATGCAAAGG + Intergenic
934868151 2:97832772-97832794 TTTTTCCTAAAACTATCTAACGG + Intronic
938745786 2:134276924-134276946 TTTGTCATAATTATTTCCAAGGG + Intronic
939293913 2:140232102-140232124 CCTATCCAAAATATATTCAAGGG - Exonic
939396374 2:141635707-141635729 TTAAGCCAAAATATATTCAAAGG - Intronic
939784349 2:146491382-146491404 TTTGCCTTAAATATATCCAAAGG + Intergenic
940238587 2:151538341-151538363 TTTTTCCTAAATGTATTCATGGG - Intronic
940411349 2:153367169-153367191 TTTATCTTAAATTGTTCCAAAGG + Intergenic
941040616 2:160618572-160618594 ATTATCCTAAAGATATAGAAAGG + Intergenic
941237365 2:162991992-162992014 GTTATACTCAATATATACAAAGG - Intergenic
942608680 2:177718508-177718530 TTTAAACTAAAAATATCCAATGG - Intronic
943348148 2:186765303-186765325 TATATCCAAAGTATATACAAAGG - Exonic
943497210 2:188636046-188636068 ATTATACTAAATAAATTCAATGG - Intergenic
944185445 2:196943121-196943143 TTTCCCCTAAATAGATCCAAAGG + Intergenic
945373468 2:209050742-209050764 TTTATCTTCAATATATATAATGG + Intergenic
945580564 2:211590112-211590134 TTTACACTAAAAATATCCATAGG + Intronic
946109538 2:217402444-217402466 TTTTTCCATAATATTTCCAATGG + Intronic
946227894 2:218274279-218274301 TTAATCCTAACTATATCCTTGGG + Exonic
946681754 2:222224324-222224346 TTTAGGCTAAATAAATCCAGAGG + Intronic
947798617 2:232911205-232911227 TTTTGCATATATATATCCAATGG + Intronic
947982493 2:234422240-234422262 TTTATCTTAAAGATATCTACAGG - Intergenic
1168732739 20:101039-101061 TAAATACTAAATACATCCAATGG - Intergenic
1169373413 20:5045809-5045831 TTTTTCCTAAATACATGCAGAGG + Intergenic
1174672528 20:52321484-52321506 TTTATCCTAAGAATCTCCCAGGG + Intergenic
1174941637 20:54935534-54935556 TTGATCCTTAAAATCTCCAAAGG - Intergenic
1175650143 20:60714741-60714763 ATTATCCCACATTTATCCAATGG - Intergenic
1177112074 21:17040699-17040721 TTCATATTAAATAGATCCAAGGG - Intergenic
1177306596 21:19326439-19326461 TTAATCCAAAATATATCAACCGG - Intergenic
1177434548 21:21034005-21034027 TCTAGCCTAAATCTCTCCAAAGG - Intronic
1177478356 21:21652918-21652940 TTTATGTTAAATATTTCCTAAGG - Intergenic
1177700338 21:24631555-24631577 TTTCTCCTATCTTTATCCAAAGG - Intergenic
1178020313 21:28400717-28400739 TTTATCTGAAATATTTCAAATGG + Intergenic
1178033285 21:28552708-28552730 TATATCTTACATACATCCAAAGG + Intergenic
1178071654 21:28974998-28975020 TTTATTTTATATTTATCCAAAGG - Intronic
1178979311 21:37248537-37248559 TTTATCCAAAATCACTCCAAGGG + Intronic
1179282666 21:39947674-39947696 TTTTTCCTTAATATATTCAAAGG + Intergenic
1179456358 21:41503551-41503573 TTTATTCTGCATACATCCAAAGG + Intronic
1182995893 22:34812258-34812280 TTTATCTAAAAAAAATCCAAAGG + Intergenic
949151142 3:768709-768731 TTTATCATAAATATTTTTAAGGG - Intergenic
949785929 3:7741867-7741889 TTTCTGCAAAATTTATCCAAAGG + Intergenic
949847433 3:8386184-8386206 TTTCTCCTTAATAAATCCCAAGG - Intergenic
951772646 3:26275865-26275887 TTTGTCCGAAATATAACCCAGGG - Intergenic
952620407 3:35332335-35332357 GTTAGCATAAATATAACCAAGGG - Intergenic
953044021 3:39279814-39279836 TGTAGCCTAAATATGTCCAAGGG - Intronic
955016815 3:55078217-55078239 TTGATACCAAACATATCCAAAGG + Intergenic
955102537 3:55865113-55865135 TATAACCTAGATATATACAAAGG - Intronic
955870120 3:63429344-63429366 GGTCTCCAAAATATATCCAATGG + Intronic
956238328 3:67100833-67100855 ATTATCCTGTAGATATCCAATGG - Intergenic
958072674 3:88634774-88634796 TAAATCCTAAATAAATCAAAAGG - Intergenic
958094307 3:88922594-88922616 TTTATTCTAAGTATATCATATGG - Intergenic
958171605 3:89946674-89946696 TTCATTCTAAATCTCTCCAAAGG - Intergenic
958772273 3:98439049-98439071 TTTTTTCTAAATAAATTCAAGGG - Intergenic
958793152 3:98675610-98675632 TTCATGCTGAAGATATCCAAAGG - Intergenic
959819203 3:110712335-110712357 TTTATTCTAAACAACTCCAAAGG + Intergenic
959841107 3:110976400-110976422 TTTCTCCTTAAAATCTCCAATGG - Intergenic
960348122 3:116560195-116560217 TATTTTCTAAATATATTCAATGG - Intronic
960842209 3:121971369-121971391 TTTAACCTAAGAATGTCCAATGG - Intergenic
961036449 3:123645626-123645648 TTTATCCTATAGATATTCACAGG + Intronic
962002977 3:131318777-131318799 TTTATAATATTTATATCCAATGG + Intronic
962648272 3:137462267-137462289 TCTCTCCTAGATATCTCCAATGG - Intergenic
963711382 3:148751505-148751527 TTTACTCTAAATATTTCCATAGG + Intergenic
964024746 3:152058687-152058709 ATTATTCAATATATATCCAAAGG - Intergenic
964107081 3:153050914-153050936 TTTTTTCTAACAATATCCAAAGG + Intergenic
964390166 3:156188339-156188361 TTTATGGTAAATATACCAAAAGG - Intronic
964864891 3:161246537-161246559 TTTATTCTAAAAAGATCGAAGGG + Intronic
965036172 3:163440601-163440623 TTTATCATAAATATGTCCTTTGG + Intergenic
965304522 3:167046994-167047016 TTTCTCCCAAAGATATCCACTGG - Intergenic
965895863 3:173574829-173574851 TTTATCTTAACTGCATCCAAGGG - Intronic
965994446 3:174862625-174862647 TTTAGTCGAAATATATTCAAGGG + Intronic
968178526 3:196571857-196571879 TTTATCCTCAAAATATTCAAGGG - Intronic
969041908 4:4305198-4305220 TTTATCCTGAAAATGTCTAATGG - Intronic
970290658 4:14568159-14568181 TATATCCTAAACATATCTCATGG + Intergenic
970830565 4:20335024-20335046 TTCATCTTAGATATATGCAATGG + Intronic
972700247 4:41487300-41487322 TCTATCCTAAATAGATGGAATGG + Intronic
972934662 4:44118467-44118489 ATAATCCTAGGTATATCCAAGGG + Intergenic
974305808 4:60138572-60138594 TTTATTCTAATTCTCTCCAAAGG + Intergenic
974317102 4:60296558-60296580 TTTATCCAGCAAATATCCAAAGG + Intergenic
974516732 4:62924262-62924284 ATTATCCTAAAAATACCAAAGGG - Intergenic
975421109 4:74165840-74165862 TTTAGCCTAAATATTTTCACAGG + Intronic
977088307 4:92633786-92633808 TTTATCCTAAACTTAACTAAAGG + Intronic
977122411 4:93119771-93119793 TGTTTCCTAAATCTTTCCAAAGG - Intronic
977805956 4:101298116-101298138 TTTCTCCTATATATATCCTAGGG + Intronic
977958408 4:103056553-103056575 TATATTTTAAATATACCCAATGG + Intronic
978281557 4:107022102-107022124 TTTTTCATAAAGATTTCCAAGGG - Intronic
978952654 4:114579817-114579839 TTTATCCTAAAGTTATTCAGGGG + Intergenic
979628588 4:122874928-122874950 AATATCCTAAACATATCCATAGG + Intronic
980214050 4:129828270-129828292 GTTATCCCAAACATATACAATGG + Intergenic
980706378 4:136501340-136501362 TTTATCTTAAATATATACTTAGG + Intergenic
980721784 4:136706964-136706986 TTTGCCCTAAATGTATCCCATGG - Intergenic
981285187 4:143009369-143009391 TTTATTCTGAATTTTTCCAATGG - Intergenic
982416410 4:155137853-155137875 TTTTTGATAAATCTATCCAAAGG + Intergenic
982924051 4:161313353-161313375 TTAATTCTAAATGTATCTAAAGG + Intergenic
983092930 4:163526586-163526608 TTTATCTTAAATATTTAAAATGG + Exonic
983200257 4:164853331-164853353 TTTTTCCCAAATATTTCCATTGG + Intergenic
983473799 4:168189815-168189837 TTTATACTAAATAGACCTAACGG + Intergenic
984109135 4:175588602-175588624 TTAATCCTAAATAAATGGAAAGG - Intergenic
984203931 4:176763042-176763064 TTTCTCCTGATTATATCCCAAGG - Intronic
984852124 4:184163313-184163335 TTTACCCCCAATATATACAAAGG - Intronic
985224176 4:187741756-187741778 TTAATCCGAAATTTAGCCAAAGG + Intergenic
986562283 5:9072766-9072788 TTTGTCCTAAAAATATGCTAAGG - Intronic
987124729 5:14801553-14801575 TGTATGCTAAAAATCTCCAAAGG + Intronic
987627292 5:20418621-20418643 TTTGTTTTAAATATATCCATTGG - Intronic
987854890 5:23407977-23407999 TTTATACTTTATATATCAAATGG + Intergenic
988737121 5:34033564-34033586 ATAATCCCAAATATAACCAAGGG + Intronic
990260141 5:54013396-54013418 TTTAAACTAAATCTCTCCAATGG - Intronic
990965209 5:61439164-61439186 CTTTTCCTATATATAGCCAAAGG - Intronic
991443303 5:66674288-66674310 TTTCTTTTAAATATATCCAGAGG + Intronic
992174320 5:74134390-74134412 TATATCCTAAAAATATCCCTTGG - Intergenic
993019273 5:82571816-82571838 TATTTCCTAAATATAGCCAGAGG + Intergenic
994288458 5:97998035-97998057 ATAATCATAAATATAGCCAAGGG + Intergenic
994543027 5:101124224-101124246 TTTATCATTAATATATTCAATGG + Intergenic
995234131 5:109806906-109806928 TTTCTCCTAAATATAGAGAAAGG + Intronic
995619408 5:114007409-114007431 ATGATCCTGAATATTTCCAAGGG - Intergenic
997407100 5:133658688-133658710 TTTATCCTTAAAAAATTCAAAGG - Intergenic
997810074 5:136958585-136958607 TTTTTCCAAAATACAGCCAAAGG - Intergenic
998302995 5:141043976-141043998 TTTAACCTCAATCTAACCAAGGG + Intergenic
998311171 5:141134358-141134380 TTTATGTTGAATATATTCAAAGG - Intronic
998992028 5:147827863-147827885 TTAATGCTAAATATATAAAAGGG + Intronic
999137153 5:149329519-149329541 TTCACACTAAATATATCTAAGGG + Intronic
1000527700 5:162379165-162379187 CTTATCCTAATTATCTCCAAAGG + Intergenic
1000836808 5:166165202-166165224 TGTATCCTAATTATTTCCCAGGG - Intergenic
1000839497 5:166199631-166199653 TTTATTCTAAGTCTATCCAGAGG + Intergenic
1000893057 5:166822203-166822225 TTTATTATAAATGTATCTAAGGG + Intergenic
1007067215 6:39003037-39003059 TTATTCCTAAATGAATCCAAAGG + Intronic
1008132717 6:47737267-47737289 TTTATTAAAAATATATCCACAGG + Intergenic
1009225731 6:61018771-61018793 ATTATTCTAAATATCTCAAAGGG - Intergenic
1009913383 6:69961889-69961911 TTTATACTAATTATATGAAAGGG - Intronic
1010497244 6:76549815-76549837 TTAAACTTAAATATATCCATAGG + Intergenic
1010964636 6:82190184-82190206 TTTATTCTAAATGTTACCAATGG - Intronic
1011905624 6:92363663-92363685 TTTATACTAAATCAATTCAAAGG + Intergenic
1013789581 6:113821821-113821843 TTCATCCTAAAAATTACCAATGG + Intergenic
1014677861 6:124389986-124390008 TTTATCCTGAAGATATCTGAAGG + Intronic
1016034021 6:139367371-139367393 GTTATCCAAAATACATGCAACGG + Intergenic
1016293869 6:142553002-142553024 TTTTTCCAAAATAATTCCAAGGG + Intergenic
1017331509 6:153204167-153204189 TTTCTTCTAAAAAAATCCAATGG + Intergenic
1017412080 6:154178471-154178493 TTTATGTTAAAAATATCGAAGGG + Intronic
1017471324 6:154739610-154739632 GGTATCCTAAATATAACTAAAGG - Intronic
1017479975 6:154843275-154843297 TTTATCATGAATATATTCATGGG - Intronic
1017982651 6:159414944-159414966 TTTCTCCTCCAAATATCCAAAGG + Intergenic
1018319698 6:162594349-162594371 AATCTCCTAAATATATCCAATGG + Intronic
1020744266 7:12061893-12061915 AATATCCAATATATATCCAAAGG + Intergenic
1021349700 7:19576209-19576231 TCTATGCAAAAAATATCCAATGG + Intergenic
1021731392 7:23598393-23598415 TTTATCTTAAACCTAACCAAAGG + Intronic
1022820172 7:33951674-33951696 TTTATCCAACATATATTCAGGGG - Intronic
1023465539 7:40450366-40450388 TTTTTCTTAAATATATCCAAAGG + Intronic
1024329497 7:48141958-48141980 TATATCCAAGATATTTCCAAGGG - Intergenic
1028130851 7:87170923-87170945 ATTATTCTAAAAATATCCATGGG - Intronic
1030799867 7:113836530-113836552 TTTATACTCTATATATACAAGGG + Intergenic
1031271386 7:119653813-119653835 TTTAATATAAATTTATCCAATGG - Intergenic
1031340931 7:120600241-120600263 TGTCTCCTAAGTATATACAAGGG - Intronic
1031492725 7:122409094-122409116 TTTAACCAAAAAATATTCAAAGG - Intronic
1032566351 7:132950782-132950804 TTTATCAAAATTACATCCAAGGG + Intronic
1032847111 7:135760822-135760844 TTTATCCTAAAGATATGAATTGG - Intergenic
1033542414 7:142369207-142369229 AATATCCAAACTATATCCAAAGG + Intergenic
1036010509 8:4716404-4716426 TTTTTCATAAATGTATACAAGGG + Intronic
1037277110 8:17192284-17192306 TTTATCCTAAAGATAGGCAAAGG - Intronic
1038378274 8:27065175-27065197 TTTATGCTAAATCTGGCCAAAGG - Intergenic
1038810943 8:30842342-30842364 TTTTTCCTAAATCTTTCCTAGGG + Exonic
1039113499 8:34066089-34066111 TTTATCCTTTATACATCCAGAGG - Intergenic
1042381690 8:68122758-68122780 TTTATCCAAAAGTTATTCAAGGG + Intronic
1042673334 8:71288055-71288077 TTTTTCCTAATTGTATTCAAAGG + Intronic
1043449249 8:80349972-80349994 TTAATTGTAAATATCTCCAATGG - Intergenic
1044042159 8:87384222-87384244 TATATCTTAAAAATATCTAATGG - Intronic
1044747515 8:95385097-95385119 TTTCTTCTAAATACCTCCAATGG + Intergenic
1046074255 8:109298637-109298659 TTTGTCATAAATATAACCCAGGG + Intronic
1046286587 8:112100976-112100998 TTTATCTTAACAATAACCAAGGG + Intergenic
1046419226 8:113957688-113957710 TATATCCTAAATCTTTTCAATGG - Intergenic
1046437911 8:114217787-114217809 ATTAACCTAAATATATGTAAAGG + Intergenic
1046769310 8:118102409-118102431 TTTTTCCTAACATTATCCAAGGG - Intronic
1047074193 8:121381478-121381500 TTTCTACTGAATATCTCCAAGGG - Intergenic
1048629268 8:136224219-136224241 TTTATCCTTTTTATAACCAAAGG - Intergenic
1050194966 9:3072852-3072874 TTTTAACTAAATATTTCCAATGG - Intergenic
1050462663 9:5890336-5890358 TTTATCCTAAAAATATTGTATGG + Intronic
1051118639 9:13727439-13727461 TTTATCCTACATTTGTCCCATGG - Intergenic
1051375681 9:16400026-16400048 TTTCTCCTACAAATATCCAAAGG - Intergenic
1053581389 9:39408206-39408228 TTTATCCTATATAAATATAAAGG + Intergenic
1054102970 9:60966958-60966980 TTTATCCTATATAAATATAAAGG + Intergenic
1054583386 9:66939855-66939877 TTTATCCTATATAAATATAAAGG - Intergenic
1054953362 9:70879441-70879463 TTTCTCCTAAATCTTTACAATGG + Intronic
1055601986 9:77929222-77929244 TTTCTCCAAAATACATCCAGAGG - Intronic
1058537990 9:105981900-105981922 CTTATCCTCAATATCTCAAAGGG + Intergenic
1059686181 9:116638687-116638709 TTTATCCATAAAATATCCCAAGG + Intronic
1060650109 9:125318468-125318490 TTTTTCCAAATCATATCCAAAGG - Intronic
1185920721 X:4089004-4089026 TTTTTCCTAAATATATTCACTGG - Intergenic
1185943098 X:4343203-4343225 TTTATCTTCAAAATATACAAAGG - Intergenic
1186462616 X:9760424-9760446 TTTATACAAAATGCATCCAATGG + Intronic
1186799155 X:13075963-13075985 TTTATCCCAGATATTCCCAAAGG + Intergenic
1187899593 X:24015125-24015147 TTTTTCCTACTTATAACCAAGGG + Intronic
1189028399 X:37424151-37424173 TTTATACTAAATATATATGAAGG + Intronic
1194319675 X:92429123-92429145 CTTCTCCTAAATAAATCCAACGG - Intronic
1194335059 X:92635478-92635500 TTGAACATAAATTTATCCAAAGG - Intergenic
1194607176 X:95995059-95995081 TTTTTTCTGAATATATCAAAAGG + Intergenic
1194643161 X:96427581-96427603 TTTTTCCTAAATATATACCCAGG - Intergenic
1200627803 Y:5542256-5542278 CTTCTCCTAAATAAATCCAATGG - Intronic
1200643532 Y:5752529-5752551 TTGAACATAAATTTATCCAAAGG - Intergenic
1200931316 Y:8699589-8699611 TTTATCCTATTTCTATCCAAGGG - Intergenic
1201494984 Y:14583299-14583321 TTTTTCTTAAATACATCCATGGG - Intronic
1202038747 Y:20661324-20661346 TGTATCCAAGATATTTCCAAGGG - Intergenic
1202375990 Y:24237734-24237756 GTTTACCTAAAAATATCCAAAGG - Intergenic
1202494790 Y:25432384-25432406 GTTTACCTAAAAATATCCAAAGG + Intergenic