ID: 1064133474

View in Genome Browser
Species Human (GRCh38)
Location 10:12730493-12730515
Sequence CTATAGATACACATTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064133466_1064133474 8 Left 1064133466 10:12730462-12730484 CCGTTGGATATATTTAGGATAAA 0: 1
1: 0
2: 3
3: 27
4: 316
Right 1064133474 10:12730493-12730515 CTATAGATACACATTGGGGGTGG No data
1064133463_1064133474 30 Left 1064133463 10:12730440-12730462 CCAAGTGAAGAGTTTGAATAGGC 0: 1
1: 0
2: 4
3: 14
4: 182
Right 1064133474 10:12730493-12730515 CTATAGATACACATTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064133474 Original CRISPR CTATAGATACACATTGGGGG TGG Intronic
No off target data available for this crispr