ID: 1064133474 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:12730493-12730515 |
| Sequence | CTATAGATACACATTGGGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064133466_1064133474 | 8 | Left | 1064133466 | 10:12730462-12730484 | CCGTTGGATATATTTAGGATAAA | 0: 1 1: 0 2: 3 3: 27 4: 316 |
||
| Right | 1064133474 | 10:12730493-12730515 | CTATAGATACACATTGGGGGTGG | No data | ||||
| 1064133463_1064133474 | 30 | Left | 1064133463 | 10:12730440-12730462 | CCAAGTGAAGAGTTTGAATAGGC | 0: 1 1: 0 2: 4 3: 14 4: 182 |
||
| Right | 1064133474 | 10:12730493-12730515 | CTATAGATACACATTGGGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064133474 | Original CRISPR | CTATAGATACACATTGGGGG TGG | Intronic | ||
| No off target data available for this crispr | |||||