ID: 1064137537

View in Genome Browser
Species Human (GRCh38)
Location 10:12763940-12763962
Sequence CTGTGGGGGTGGGGGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1234
Summary {0: 1, 1: 0, 2: 11, 3: 182, 4: 1040}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064137537_1064137549 -5 Left 1064137537 10:12763940-12763962 CCCTGTGGCCCCCACCCCCACAG 0: 1
1: 0
2: 11
3: 182
4: 1040
Right 1064137549 10:12763958-12763980 CACAGCCCTCCTGTTGGGATCGG No data
1064137537_1064137544 -10 Left 1064137537 10:12763940-12763962 CCCTGTGGCCCCCACCCCCACAG 0: 1
1: 0
2: 11
3: 182
4: 1040
Right 1064137544 10:12763953-12763975 ACCCCCACAGCCCTCCTGTTGGG No data
1064137537_1064137551 -3 Left 1064137537 10:12763940-12763962 CCCTGTGGCCCCCACCCCCACAG 0: 1
1: 0
2: 11
3: 182
4: 1040
Right 1064137551 10:12763960-12763982 CAGCCCTCCTGTTGGGATCGGGG No data
1064137537_1064137555 2 Left 1064137537 10:12763940-12763962 CCCTGTGGCCCCCACCCCCACAG 0: 1
1: 0
2: 11
3: 182
4: 1040
Right 1064137555 10:12763965-12763987 CTCCTGTTGGGATCGGGGATGGG No data
1064137537_1064137550 -4 Left 1064137537 10:12763940-12763962 CCCTGTGGCCCCCACCCCCACAG 0: 1
1: 0
2: 11
3: 182
4: 1040
Right 1064137550 10:12763959-12763981 ACAGCCCTCCTGTTGGGATCGGG No data
1064137537_1064137554 1 Left 1064137537 10:12763940-12763962 CCCTGTGGCCCCCACCCCCACAG 0: 1
1: 0
2: 11
3: 182
4: 1040
Right 1064137554 10:12763964-12763986 CCTCCTGTTGGGATCGGGGATGG No data
1064137537_1064137556 3 Left 1064137537 10:12763940-12763962 CCCTGTGGCCCCCACCCCCACAG 0: 1
1: 0
2: 11
3: 182
4: 1040
Right 1064137556 10:12763966-12763988 TCCTGTTGGGATCGGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064137537 Original CRISPR CTGTGGGGGTGGGGGCCACA GGG (reversed) Intronic
900102854 1:970221-970243 CGGAGGGGGTGGGGGGCCCAGGG + Intronic
900306356 1:2010799-2010821 CTTAGGGGGTGGGGGGCACAGGG - Intergenic
900363069 1:2299248-2299270 CGGGGAGGGGGGGGGCCACACGG + Intronic
900380138 1:2379884-2379906 CTCTGGGGCTGTGGCCCACAGGG + Intronic
900382364 1:2391299-2391321 CTGTGGGAGTGGGGGACGCGGGG + Intronic
900407782 1:2500022-2500044 CTGTAGGGGTGGAGGCTGCAAGG - Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900432758 1:2610782-2610804 CTCTGGGGCTGGGGACCTCACGG + Intronic
900493736 1:2966690-2966712 CTGTGAGAGTGGAAGCCACAGGG - Intergenic
900560731 1:3304814-3304836 CTGAGGAGGAGGAGGCCACAGGG - Intronic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
900987417 1:6081209-6081231 CTGTGGTGGTGGCTGCCTCATGG - Intronic
901197226 1:7447006-7447028 CTGTCGGGGTTTGGGCCAGATGG + Intronic
901737091 1:11319526-11319548 CTGGGGGGTTGGGGGAGACAGGG + Intergenic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
902271258 1:15306815-15306837 CTGTGGGGTCGGGGCCCTCATGG + Intronic
902332077 1:15735598-15735620 CAGTGGGGGTGGGGGCGAGCAGG + Intergenic
902380811 1:16051455-16051477 CTGTGGGAGTGGGGAGCCCAGGG - Intronic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
903047161 1:20573437-20573459 ATGTGGGGGTGAGGGAAACAAGG + Intergenic
903053448 1:20618647-20618669 CTGTAGGGCTGGGGCCCACTGGG - Exonic
903248943 1:22038193-22038215 CAGTGGGTGTGGGGGCCACGAGG + Intergenic
903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG + Intronic
904005837 1:27362757-27362779 GGGTGGGGGTAGGGGGCACAGGG + Intronic
904826295 1:33275966-33275988 CTGTGAGGCTGGGGGACCCACGG + Intronic
905290257 1:36916790-36916812 CTGCAGGGGTGGGGCCCTCATGG + Intronic
906164803 1:43678254-43678276 CTGTGGGTGTGGGAGTCACCAGG + Intronic
906190399 1:43895306-43895328 CTGTGTGGGTGAGGTCCCCAAGG - Intronic
906241441 1:44244774-44244796 CTGTAGGGGAGGGGGCTACTAGG - Intronic
906651404 1:47515560-47515582 CTGTTGGAGAGGGGGCCACCTGG + Intergenic
906706956 1:47901931-47901953 CTGTGGGGCAAGGAGCCACAGGG + Intronic
906717427 1:47980466-47980488 CCATGGGGGTGGGGGACTCAGGG + Intronic
906992694 1:50755663-50755685 CTGTGGGGGTGGGGCACTCCTGG - Intronic
907004205 1:50893959-50893981 CTGTGGTGGTGGTTACCACAGGG - Intronic
907625116 1:56022224-56022246 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
907685780 1:56609796-56609818 CTGCAGGGGTGGGGTCCTCATGG - Intronic
908487640 1:64610872-64610894 CTGTAGGGGTGGGGCACTCATGG - Intronic
908770308 1:67589992-67590014 CTGTGGGGGAGGGGGCGCCTGGG - Intergenic
908936502 1:69383193-69383215 CTTTAGGGGTGGGGTCCTCATGG - Intergenic
909057968 1:70845190-70845212 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
909235109 1:73143121-73143143 AGGTGGGGTTGGGGGTCACAAGG + Intergenic
909235918 1:73152633-73152655 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
909369755 1:74870241-74870263 CTGTAGGAGTGGAGCCCACATGG + Intergenic
909674919 1:78227988-78228010 AAGTGGGGGTGGGAGCTACAGGG + Intergenic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
910270649 1:85390539-85390561 CTTTGGGGTTGGGGAACACATGG + Intronic
910289827 1:85589056-85589078 CCGTGGTGGTGGTGGCTACAGGG + Intergenic
910512888 1:88025770-88025792 CTGTAGGGGTGGGGTCCTCATGG - Intergenic
910628920 1:89337227-89337249 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
910716345 1:90235727-90235749 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
910728727 1:90366993-90367015 CTGTGAGGGTGGAGTCCTCATGG - Intergenic
911009356 1:93262837-93262859 CTGTGGAGGTGGAGCCCTCATGG - Intronic
911068497 1:93813125-93813147 CTCTGGGGGCTGGGGACACAGGG - Intronic
911134968 1:94429750-94429772 CTGCAGGGATGGGGCCCACATGG + Intronic
911669691 1:100593697-100593719 CAGTGGTGATGGTGGCCACAGGG - Intergenic
912043072 1:105416771-105416793 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
912263331 1:108130833-108130855 CTCGGGGGGTGGGGGACACTTGG - Intergenic
912382729 1:109255937-109255959 CGATGGCGGTGGGGGACACAGGG + Intronic
912453536 1:109783059-109783081 CAGCGGGGGTGGGGGCCAGCTGG - Intergenic
912491523 1:110065177-110065199 CTGTGGTGGTGCGTTCCACAGGG + Intronic
912507168 1:110164280-110164302 CAGTAGAGGTGGGGGACACAGGG - Intronic
912563914 1:110571586-110571608 ACGTGGGGGTGGGGGCGACTGGG + Intergenic
912610146 1:111034433-111034455 CTGTAGGGGTGGGGTCCTCATGG + Intergenic
912798096 1:112704998-112705020 TGCTGGGGGTGGGGGACACATGG - Intronic
914221501 1:145686238-145686260 CAGTGGGGGTGGGGGGCACTGGG - Intronic
914474064 1:148009107-148009129 CAGTGGGGGTGGGGGGCACTGGG - Intergenic
915022757 1:152796874-152796896 CTGAAGGGGCGGGGGCCAAAAGG + Intronic
915274091 1:154776122-154776144 CAGGGAAGGTGGGGGCCACATGG + Intronic
915694128 1:157721918-157721940 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
915963152 1:160283765-160283787 CTGGGGAGGTGGGGGACTCAAGG - Intronic
915973341 1:160368809-160368831 CTGAGAGGGAGGGGACCACAGGG + Intronic
916147044 1:161749585-161749607 CTTTGGGGGTAGGGGTCAGAGGG + Intergenic
916360624 1:163963151-163963173 CTGGGGTGGTGGTGGCCATAGGG + Intergenic
916518639 1:165543818-165543840 CTGGGGGAGTTGGGGCCTCATGG - Intergenic
916942281 1:169688516-169688538 GGGTAGGGGTGGGGGTCACAAGG - Intronic
917790451 1:178495910-178495932 CCTTGGGGGTCTGGGCCACAAGG + Intergenic
918236498 1:182585525-182585547 CTATGGGAGTGAGAGCCACAGGG - Exonic
918619261 1:186583806-186583828 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
918787079 1:188776261-188776283 CTGAAGGGGTGGGGCCCTCATGG + Intergenic
918831560 1:189405284-189405306 GTGTAGGGGTGGGGCCCTCATGG - Intergenic
919336672 1:196244578-196244600 CTGGAGTGGTGGTGGCCACAGGG + Intronic
919376091 1:196796429-196796451 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
919385795 1:196921318-196921340 CTGCAGGGGTGGGGCCCTCATGG + Intronic
919842861 1:201622213-201622235 CTATGGGGGTGGGGACAGCAGGG + Intergenic
919925128 1:202188235-202188257 ATGTAGGTGTTGGGGCCACAGGG + Intergenic
919958226 1:202439573-202439595 CAGAGGGGGTGGCGGCCACCTGG - Intronic
920110343 1:203582986-203583008 CTGTGGTGGAGGCGGCTACATGG + Intergenic
920337802 1:205256959-205256981 GGGTGGGGGTGGGGGGCAAAGGG - Intronic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
920743768 1:208606324-208606346 GTGTGGGGGTGGCGAACACATGG - Intergenic
920744963 1:208617531-208617553 CTGGGGTGGTGGTGGCTACAGGG + Intergenic
921053440 1:211527032-211527054 CTGTCTGGGTGGGGGCTGCAGGG - Intergenic
921424365 1:214984959-214984981 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
921647388 1:217634433-217634455 ATTCTGGGGTGGGGGCCACAAGG + Intronic
922377194 1:224980362-224980384 CTGTGGTGGTGGTGGCCACGGGG + Intronic
922598360 1:226831202-226831224 CTGTGGGGATAGTGGGCACATGG + Intergenic
922643118 1:227256315-227256337 CTGTTGGGGTGGGGGCCAAGAGG + Intronic
922795785 1:228338766-228338788 CTGAGGGAGTGGGGGCCTCGTGG + Intronic
923687393 1:236162817-236162839 CTGTGGGGGTGGGGCCCTCATGG + Intronic
924490767 1:244535525-244535547 CTGTGGTGGTGGTGGCCACAGGG - Intronic
1062780104 10:195724-195746 CTGTGGGGGTGAGTGCCACCAGG + Intronic
1062846908 10:714742-714764 CAGTGGGGGAGGGGGTCACCTGG - Intergenic
1062894044 10:1089379-1089401 CTCTGGGCCTGGGGGCCTCAGGG + Intronic
1063014700 10:2064309-2064331 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
1063058370 10:2526069-2526091 AAGTGGAGGTGGGGGCAACAGGG - Intergenic
1063464334 10:6233161-6233183 GAGTGGAGGTGGGGGCCCCACGG - Exonic
1063808991 10:9681752-9681774 CTGTAGGGGTGGGGTCCTCATGG + Intergenic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1065197197 10:23278113-23278135 ATGTTGGAGTGGGGGCCTCATGG - Intronic
1065226084 10:23545228-23545250 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1065381480 10:25095786-25095808 CTGTGGTGGTGGTGGCCATCAGG - Intergenic
1065998274 10:31080125-31080147 CAGTGGGGGTCTGGGCCACAGGG - Intergenic
1066013391 10:31214772-31214794 GTGTGGAGGTGGGTGCCACACGG + Intergenic
1066291487 10:34018271-34018293 CTCTGGGTGTTGGGGCCTCAGGG - Intergenic
1066373136 10:34834454-34834476 CTGTGGGGTTGTGGGAAACAGGG + Intergenic
1066746204 10:38605338-38605360 CTGGCGGGGTGACGGCCACAGGG - Intergenic
1067058221 10:43064612-43064634 GTGTGGGGGTGGGGGTCACCGGG + Intergenic
1067105131 10:43361459-43361481 CTGGGGGGGCGGGGGGGACAGGG + Intergenic
1067761458 10:49050951-49050973 GTGTGGAGGTGGGGGCTATAAGG - Intronic
1067941901 10:50663597-50663619 AAGTGGGGGTGGGGGCCAAGGGG + Intergenic
1067977286 10:51041088-51041110 GTGGGGTGGTGGTGGCCACAGGG - Intronic
1068103896 10:52590722-52590744 CTGTGGTGGTGGTGGCCAAGGGG - Intergenic
1069032327 10:63610405-63610427 CTGTCGGGGGGTGGGGCACAAGG + Intronic
1069070033 10:63983430-63983452 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1069615724 10:69805033-69805055 CTTTGAGGCTGGGGGCCAGAGGG + Intronic
1069897325 10:71687732-71687754 GTCGGGGGGTGGGGGGCACATGG + Intronic
1069933524 10:71899836-71899858 CTGTGGTGGTGGTGGCCACGGGG - Intergenic
1070863144 10:79688548-79688570 AAGTGGGGGTGGGGGCCAAGGGG + Intergenic
1071327800 10:84534267-84534289 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1071418533 10:85464293-85464315 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1071818272 10:89254210-89254232 CTGCAGGGGTGGGGCCCTCAAGG - Intronic
1071918647 10:90325117-90325139 ATTTGGGGGTGGGGGGCACAGGG - Intergenic
1072034141 10:91549126-91549148 TTTTGGGGGCAGGGGCCACAAGG + Intergenic
1072693187 10:97584765-97584787 ATGTGGGGGTCTGGGCCTCAGGG + Exonic
1072915951 10:99537398-99537420 CTCTGGGGGAGGGGGCGGCAGGG + Intergenic
1073176521 10:101560535-101560557 AAGTGGGGGTGGGGGCCCCAGGG + Intergenic
1073330314 10:102666168-102666190 CAGAGGGGGCGGGGGCCACGAGG - Intergenic
1073453177 10:103621535-103621557 CTGTGAGGGTGGGGGTCACTGGG + Intronic
1073759241 10:106612390-106612412 CTGCGGGGGTGGGGGCGGGAGGG - Intronic
1074151037 10:110759994-110760016 CAGTGGTGGTGGGGGGCACAGGG + Intronic
1074324945 10:112441076-112441098 CTGAGGCGGTGTGGGTCACAAGG - Intronic
1074432245 10:113404030-113404052 GTGTGGGGGAGGGGGCCACCAGG - Intergenic
1074766676 10:116705121-116705143 CTGTGGGTGGGAGGGCCACGTGG - Intronic
1075030861 10:119023816-119023838 GGTTGGGGGTGGGGGGCACATGG + Intergenic
1075194989 10:120348523-120348545 CTGTGGTGGTGGTGGCCATGAGG + Intergenic
1075543653 10:123337236-123337258 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1075654601 10:124152781-124152803 CTGTGGGTGTCGGGGACTCAGGG - Intergenic
1075666442 10:124234037-124234059 CTGGGTGGGTGGCAGCCACAAGG + Intergenic
1075713922 10:124545080-124545102 CTCTGGGGGCGGGGGCACCAGGG - Intronic
1076587740 10:131560849-131560871 CTGTGGGGGAGCGGGGGACAGGG + Intergenic
1076760067 10:132599697-132599719 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1077065293 11:638295-638317 CTGTGGGGGAGGGGGACTCGAGG + Intronic
1077139337 11:1016932-1016954 CCGAGGTGGTGTGGGCCACAGGG + Exonic
1077139575 11:1018111-1018133 CTGAGTTGGTGTGGGCCACAGGG + Exonic
1077170076 11:1162182-1162204 CTGGGATGGTGGGGGCCACGCGG + Intronic
1077426203 11:2479332-2479354 CTGCAGGGGTGGGGTCCTCATGG - Intronic
1077427481 11:2490149-2490171 CTGTAGTGGTGGTGGCCACAGGG + Intronic
1077431911 11:2520036-2520058 CCTGGGGGGTGGGGGCGACAGGG - Intronic
1077487780 11:2846946-2846968 CTGAGAAGGTGGAGGCCACATGG + Intronic
1078102478 11:8337950-8337972 GTGTGGCGGTGGGGGCAGCACGG - Intergenic
1078324250 11:10366745-10366767 GTGGGGGGATGGGGGGCACATGG - Intronic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1078991169 11:16647933-16647955 TTGTGGGGGAGGGGCTCACAGGG + Intronic
1079183555 11:18215380-18215402 CTGTGGTGGTAGTGGCCACGGGG + Intronic
1079248128 11:18768354-18768376 CTGAGTTGGTGGTGGCCACAGGG + Intronic
1079673631 11:23198930-23198952 CTATAGGGGTGGGGCCCTCATGG - Intergenic
1080065132 11:28002338-28002360 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1080128630 11:28766965-28766987 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1080489784 11:32750607-32750629 CTGTGGTGGTGGTGGCCATGGGG - Intronic
1080739332 11:35049195-35049217 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1080904009 11:36522507-36522529 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1082287766 11:50335471-50335493 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
1082766167 11:57169644-57169666 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1083176298 11:60952074-60952096 CAGTGGGGGTGAGGGGGACAGGG - Intronic
1083196563 11:61091940-61091962 CTGTGGGGGTGGGGGCACCCAGG - Intergenic
1083228880 11:61302549-61302571 GTGTGGGGGTGTGCCCCACAGGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083311459 11:61786008-61786030 CTCTGGGGGTGCGGGGCAGATGG - Intronic
1083328268 11:61884745-61884767 GTGTGGGGGTTGGGGGGACAGGG - Intronic
1083339347 11:61948878-61948900 GTGTGGGGGTGGGGGACAAGGGG + Intergenic
1083470797 11:62882426-62882448 CTTTGGGAGTGGGGAACACAGGG + Intronic
1083506288 11:63160512-63160534 CTGCAGGGGTGGGGTCCTCATGG + Intronic
1083671705 11:64303677-64303699 TTGGGGGTTTGGGGGCCACAGGG + Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083944008 11:65913857-65913879 CTGTTGGGGTGGGGGCTGCAAGG - Intergenic
1083968386 11:66057282-66057304 CTGTAGGAGTGGGGCCCACTGGG - Exonic
1084155424 11:67310367-67310389 TTGCAGGGGTGGGGGCCATAAGG + Intronic
1084230004 11:67744717-67744739 CTGTGGGCTTTGGGGGCACAGGG - Intergenic
1084764950 11:71302122-71302144 TCTTGGGGGTGGGGGACACAGGG + Intergenic
1084770583 11:71340526-71340548 ATGCAGGGGTGGGGGGCACAGGG - Intergenic
1084779357 11:71398256-71398278 CAGTGGTGGTGAGGGCCTCAGGG - Intergenic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1085026853 11:73241305-73241327 AGGGGAGGGTGGGGGCCACAGGG + Intergenic
1085178495 11:74511499-74511521 ATGTGGTGGTGGTGGCCACAGGG + Intronic
1085194683 11:74661952-74661974 CTGTGGTGGTGGTGGCCATTGGG - Intronic
1085505603 11:77056895-77056917 GGGTGGGGGTGGGGGGCATATGG - Intergenic
1085722133 11:78921801-78921823 CTGTGGGTTTGAGGGCCCCAAGG - Intronic
1085875761 11:80404723-80404745 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1086176780 11:83900702-83900724 CTGTAGAGGTGGGGGCCTCATGG + Intronic
1086309339 11:85519058-85519080 CTGTGGGGGCAGGGCCCTCATGG + Intronic
1086580345 11:88391783-88391805 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1087528632 11:99351014-99351036 CTGTGGGGGTGGGGGCCTAGGGG + Intronic
1087560521 11:99784294-99784316 ATGTGGGGGTGGGGGGCTAAGGG - Intronic
1087675634 11:101158306-101158328 CTGTAGGGGTGGAGCCCTCATGG + Intergenic
1087807278 11:102568792-102568814 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
1087901993 11:103651349-103651371 CTGTTGGGGTGGGGGCACAATGG + Intergenic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1088154798 11:106790258-106790280 CTATGGTGGTGGTGGCCACAGGG - Intronic
1088528785 11:110785915-110785937 ATGTGGGGTTGGAGGCCCCATGG + Intergenic
1088833320 11:113556708-113556730 TTGAGGGGGTGGGGGCCGTAGGG - Intergenic
1088985243 11:114899853-114899875 CTGTGGGGGTGGTAACCACAGGG + Intergenic
1089083340 11:115796115-115796137 CTGTGGTGGTGGCTGCCACAGGG - Intergenic
1089186507 11:116619232-116619254 CTGTGGGGGTGGGGGACTAGGGG - Intergenic
1089366699 11:117924957-117924979 CCCTGGGGGTGGGGGGCACGGGG + Intronic
1089497139 11:118913571-118913593 GAGAGGGGGTGGGGGGCACAAGG + Intronic
1089604291 11:119632792-119632814 CTGTGGGGGTGAAGGCCAACTGG + Intronic
1089695912 11:120216190-120216212 CTGTGGGTGGGGGAGCAACATGG + Intronic
1090080367 11:123608598-123608620 CGGAGGGGGAGGGGGCCCCAGGG - Intronic
1090172696 11:124618649-124618671 GTGGGGGGGTGGGGGAGACAGGG + Intronic
1090955086 11:131506517-131506539 CTGAGGAGGAGGCGGCCACAGGG + Intronic
1091065710 11:132509777-132509799 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1091356396 11:134941036-134941058 CTGTGGGGGGGGGGGGACCAGGG + Intergenic
1091775665 12:3183135-3183157 CTGGAGGGGTGGGGGCCCCAGGG + Intronic
1092093594 12:5823790-5823812 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1093521725 12:20058921-20058943 TTGTGGGGGTGGGGGCCTCGGGG - Intergenic
1093588564 12:20872152-20872174 CTGTGGTGGTGGTGGACACAGGG - Intronic
1093626016 12:21349006-21349028 CTGTGGGGGTAGGAGGCATATGG + Intronic
1093682915 12:22023676-22023698 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1093991161 12:25591384-25591406 CTGTGGTGGTGGTGGCCACAGGG + Intronic
1093991230 12:25591747-25591769 TTGTAGTGGTGGTGGCCACAGGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1095213970 12:39526884-39526906 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1096343899 12:50828530-50828552 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
1096758138 12:53817112-53817134 CTGAGGAGCTGGGGGCAACATGG - Intergenic
1096771974 12:53940770-53940792 CTTTGGGGGTGGGGGGCCCAGGG + Intronic
1096791215 12:54046396-54046418 CTGTGGGGGAGGGGGCCTGGGGG + Intronic
1096887956 12:54736434-54736456 GGGTAGGGGTGGGGGTCACAAGG - Intergenic
1096914124 12:55013554-55013576 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1096960228 12:55569958-55569980 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
1097222708 12:57460238-57460260 CAGTGGGGGAGGGGGCCTGAGGG + Intronic
1097565656 12:61265424-61265446 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1097618083 12:61907532-61907554 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1097654675 12:62344667-62344689 CTGTAGGGGCGGGGTCCTCATGG - Intronic
1098333929 12:69382463-69382485 CTGTGGTAGTGGTGGACACAGGG - Intronic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1099352589 12:81591806-81591828 CTGCAGGGGTGGGGTCCTCATGG + Intronic
1099501465 12:83419105-83419127 CTGTAGTGGTGGGGCCCTCATGG + Intergenic
1099700391 12:86075603-86075625 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1100054333 12:90490814-90490836 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
1100378664 12:94041799-94041821 CTGAGGGGATGCGGGTCACAGGG - Intergenic
1101187051 12:102290956-102290978 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
1101270423 12:103137873-103137895 GTGTGGGGGTGGGGGCATAAAGG + Intergenic
1101359040 12:104008988-104009010 CTGCAGGGGCGGGGGCCTCATGG + Intronic
1101706612 12:107226376-107226398 TGGTGGGGGTGGGGGGCAAAGGG - Intergenic
1102061837 12:109938474-109938496 GAGTGGGGCTTGGGGCCACATGG + Exonic
1102211710 12:111132046-111132068 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1102393256 12:112566862-112566884 CTCTGGGAGTGGGGCCCTCAGGG - Intergenic
1102601228 12:114032367-114032389 ATGTGAGGGTGGCTGCCACAAGG + Intergenic
1102601295 12:114032653-114032675 TTGTGGTGGTGGGGGCAACGTGG + Intergenic
1102668960 12:114601042-114601064 CTGCAGGGGTGGAGCCCACATGG + Intergenic
1102740971 12:115207295-115207317 AAGTGGGGGTGGGTGCCAGAGGG - Intergenic
1102846965 12:116195261-116195283 TGGTGGGGGTGGGGGCAACAGGG + Intronic
1103729030 12:123013787-123013809 ATGTGGAGGTGGGAGGCACATGG + Intronic
1103880759 12:124164161-124164183 CTGCAGGGGTGGGGCCCTCAAGG - Intronic
1103987456 12:124777572-124777594 TCGTGGGGGTGGGGGCCTCTGGG - Intronic
1104051153 12:125194695-125194717 CAGTGGGGTTGGGGGGCACCTGG + Intronic
1104103101 12:125634195-125634217 CTGTGGTGGTGGTGGCCCCAGGG - Intronic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1104440689 12:128791122-128791144 CCCTGGGGGTGGGGGGCACGAGG + Intergenic
1104749610 12:131229936-131229958 CTCTGGAGGGGCGGGCCACACGG + Intergenic
1104794990 12:131511119-131511141 CTGTGAGGGTGAGAGCCCCACGG - Intergenic
1104821280 12:131679003-131679025 CTGTGGGGGTTTGGGTCCCAGGG - Intergenic
1104880071 12:132064708-132064730 CTGTGGCGGTGGGGGCTGCGGGG - Exonic
1104904026 12:132203992-132204014 CACTGGGGGTGGGAACCACAGGG - Intronic
1105609428 13:21955073-21955095 CTGTAGGGGCGGGGTCCTCATGG - Intergenic
1106618908 13:31355438-31355460 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
1106724393 13:32469568-32469590 CAGTGGGGGTGGGGGTCCCTAGG - Intronic
1106882590 13:34148253-34148275 CTGTGGGAGAGGGTGGCACATGG - Intergenic
1107961954 13:45566712-45566734 CTGTAGGGGCGGGGTCCTCATGG + Intronic
1108255906 13:48611129-48611151 CTGTGGAGTTGGTGGCCACAAGG - Intergenic
1108797024 13:54044175-54044197 CTGTGGGTGTGGGACCCACCAGG - Intergenic
1109084368 13:57951243-57951265 CTGTAGGGGTTGGGTCCTCATGG - Intergenic
1109286837 13:60419628-60419650 TTGTGGGGGCGGGGGGCAAAGGG + Intronic
1109308051 13:60662168-60662190 CTGGGGGGGTGGGGGTGGCAGGG - Intergenic
1109334117 13:60971181-60971203 CTTTAGGGGTGGGGCCCTCATGG + Intergenic
1109336643 13:61003252-61003274 CTATGGTAGTGGTGGCCACAAGG - Intergenic
1109402832 13:61857654-61857676 CTGGGGTGGTGGTGACCACAGGG - Intergenic
1109951943 13:69511031-69511053 CTGTGGGGGCAGGGCCCTCAGGG + Intergenic
1109993350 13:70087911-70087933 CTGTTGGGGTTGGGGGCATAGGG + Intronic
1110501352 13:76231719-76231741 CTGTGGTGGTGATGGCCACAAGG + Intergenic
1111568485 13:90047771-90047793 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
1111641948 13:90980219-90980241 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
1111715759 13:91877138-91877160 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1112620294 13:101047718-101047740 CTGTGGGTGGAGGGGCCACCTGG - Intergenic
1112623641 13:101078153-101078175 CTGTGGGGGTAGAGCCCTCATGG + Intronic
1112907803 13:104445892-104445914 CTGTCGGGGTGGGGGTCAAGGGG + Intergenic
1113597805 13:111547034-111547056 GTGTGGATGTGGGGGCCACGTGG + Intergenic
1114250947 14:20959790-20959812 CTGTGGTGGAGGTAGCCACAGGG + Intergenic
1115648757 14:35388213-35388235 CCGTGGCGGTAGTGGCCACAGGG + Intergenic
1115840277 14:37462077-37462099 CTGTAGGGATGGGGTCCTCATGG - Intronic
1115919393 14:38355629-38355651 CTGCCGGGGTGGGGACCTCATGG + Intergenic
1116293513 14:43074082-43074104 CTGTAGGGGCGGGGTCCTCATGG + Intergenic
1116296639 14:43119618-43119640 CTATAGGGGTGGGGCCCTCATGG - Intergenic
1117159329 14:52973437-52973459 CTGTGGTGGTGATGGCCACAGGG - Intergenic
1117250759 14:53935209-53935231 CTGTGGTGGGAGGGGGCACATGG - Intergenic
1117758250 14:58998835-58998857 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
1118047998 14:61993257-61993279 CTGTGGGGGTGTGGGGGGCAAGG + Intergenic
1118084360 14:62398451-62398473 CTGTGTTGGTGGCAGCCACAGGG - Intergenic
1118402845 14:65395378-65395400 CTGCAGGGGAGGGGCCCACATGG - Intergenic
1118543596 14:66858882-66858904 CTGTTGTGGTGGTGGCCATAAGG + Intronic
1118721060 14:68594121-68594143 GTGTGGGGGTGGGGAGCACGGGG - Intronic
1118762682 14:68890287-68890309 CTGTGGGGATGGGAGGTACAGGG + Intronic
1119142975 14:72284591-72284613 CTGTAGGGGTGGGGCCCTCATGG + Intronic
1119200564 14:72748913-72748935 CTGTAGGGGTGAGGTCCTCATGG + Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119419797 14:74501694-74501716 CTGTGGGGGTGGGGGCAGAGAGG + Intronic
1119759311 14:77140060-77140082 TTGTGAGGGTGGGGGGCACCGGG + Intronic
1119850126 14:77861133-77861155 TTGTGGGGGCAGGAGCCACATGG - Intronic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1120621436 14:86769748-86769770 TCGTGGGGGTGGGGGCCTAAGGG + Intergenic
1120696820 14:87654002-87654024 CTGTGCAGGTGGGGGCTAAAGGG + Intergenic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1120841677 14:89091118-89091140 TTGTGAGGGTGGGGGTCCCATGG - Intergenic
1120898033 14:89551756-89551778 CGGTAGGGGTGGGGGCAACCAGG - Intronic
1121253302 14:92514706-92514728 AGGTGGGGCTGGGGGCGACAAGG - Intronic
1121323188 14:93004773-93004795 GTGTGGGTGCGGGGGGCACAGGG + Intronic
1121437393 14:93928552-93928574 CGGCGGGGGTGGGGGCTGCAAGG + Exonic
1121739663 14:96242612-96242634 GTGTGGCGGTTGGGGCCTCAGGG - Exonic
1122251290 14:100441593-100441615 CAGATGGGCTGGGGGCCACATGG + Intronic
1122266619 14:100549740-100549762 CTGTGTGGGGTGGGGCCACCAGG + Intronic
1122280903 14:100621978-100622000 CTGTGGGGGGTGTGGTCACACGG - Intergenic
1122340602 14:101025851-101025873 CTGCGGGGGTGGGGGCCACTAGG + Intergenic
1122695743 14:103551229-103551251 CTGTGGGGGTGGAGGCGGCCTGG + Intergenic
1122696273 14:103554302-103554324 GGGTGGGGGTGGGGGTCACCAGG - Intergenic
1123035613 14:105470779-105470801 CGATGGGGGTGGGGGGCCCAGGG - Intergenic
1123054268 14:105561783-105561805 CAGGGGGGGTGGGGGCTGCAGGG - Intergenic
1123078852 14:105682202-105682224 CAGGGGGGGTGGGGGCTGCAGGG - Intergenic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123508593 15:20972120-20972142 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1123565814 15:21545869-21545891 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1123602076 15:21983156-21983178 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1123696846 15:22884750-22884772 CTGTGGGGGTGGAGCCATCATGG - Intronic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124171349 15:27376451-27376473 CTGTAGGGGTGGGGCCCTCATGG - Intronic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1124358839 15:29019232-29019254 CTGTGGGGCTGGGCCTCACACGG + Intronic
1124632266 15:31344606-31344628 CTGTGGGGGTTTGGGCCAGTGGG + Intronic
1124695812 15:31863383-31863405 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1124845352 15:33284584-33284606 CTCTAGGGGTTGGAGCCACACGG + Intergenic
1125181819 15:36887454-36887476 AGGTGGGGGTGGGGGCGAAAGGG + Intergenic
1125610036 15:40963712-40963734 ATGTGGGGCTGGAAGCCACATGG + Intergenic
1126015730 15:44348439-44348461 CTGTGGTAGTGGTGGACACAGGG + Intronic
1126126409 15:45298226-45298248 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1126518160 15:49558197-49558219 CAGTGTGGGTAGGGGTCACACGG - Intronic
1126942071 15:53778537-53778559 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127173536 15:56328660-56328682 CTGTGGTAGTAGTGGCCACAAGG + Intronic
1127492294 15:59476533-59476555 CTTTGGGTGTGGGATCCACAAGG + Intronic
1127806024 15:62521284-62521306 CCGTGAGGGTGGGGGGTACAGGG + Intronic
1128230806 15:66033665-66033687 GTGTGGGGGTTGGGCCCCCAAGG - Intronic
1128237924 15:66080135-66080157 CTGGGGGGCTGTGGGCCGCAGGG - Intronic
1128719898 15:69940567-69940589 CTGTGGTGGTGGGGGCATGAGGG - Intergenic
1128756415 15:70186613-70186635 ATGATGGGGTGGGGGCCAGAGGG - Intergenic
1128901004 15:71422954-71422976 CTGTGGAGGTGGTGGCCACGGGG - Intronic
1128966292 15:72061566-72061588 CTGGGGAGGTGGTAGCCACAGGG + Intronic
1129030503 15:72614608-72614630 CAGTGGTGGTGGTGGCCATAGGG - Intergenic
1129169185 15:73797525-73797547 CTGTGGGAGTGGGGCGCCCATGG + Intergenic
1129324726 15:74794091-74794113 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129324783 15:74794256-74794278 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129324804 15:74794311-74794333 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129355515 15:74988214-74988236 CTGTGGGCGTGGGTGCCCCCAGG + Intronic
1129393936 15:75234249-75234271 GTGTTGGGGTGGGAGGCACAGGG - Intergenic
1129498577 15:76013493-76013515 CTGTCGGGGTGGGGGGCTAAGGG - Intronic
1129875619 15:78973613-78973635 CTGGGGTGGTGGGGGCAACATGG + Intronic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130966409 15:88700916-88700938 CTCTTGGGGTGGGGGGCGCAGGG - Intergenic
1130991563 15:88878919-88878941 CTGTGGGTTTGGTGGCCACCTGG - Intronic
1131048536 15:89331761-89331783 GGGTGGGGGTGGGTGCCACATGG - Intronic
1131416033 15:92258630-92258652 TTGTGGGGGTGGGGGCCGAGGGG + Intergenic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1131556512 15:93404367-93404389 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1131716303 15:95114194-95114216 CAGTGGTGGTGGTGGCCATAGGG + Intergenic
1131728934 15:95258617-95258639 CTGTGATGGTGGGTGCCAAAAGG - Intergenic
1131980200 15:97987243-97987265 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
1131982617 15:98010098-98010120 ATGTGGGGGTGGGGGCCCAGAGG - Intergenic
1132045184 15:98557638-98557660 GGGTGGGGGGGGGGACCACAGGG + Intergenic
1202974183 15_KI270727v1_random:272962-272984 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1132467946 16:86224-86246 GTGCTGGGGAGGGGGCCACAGGG + Exonic
1132542032 16:514701-514723 CTCTGGGAGTGGGGCCCCCAGGG + Intronic
1132561241 16:595250-595272 AGGTGGTGGTGGGGGCTACACGG - Intronic
1132678699 16:1130997-1131019 CAGTGGGGGTGGGAGTCCCAGGG + Intergenic
1132995600 16:2820864-2820886 CTGCGGGGGTGGGGGCCCTGGGG - Intronic
1133030218 16:3007293-3007315 CTTTGAGGGTGGGGGCCCCGTGG - Intergenic
1133100513 16:3476398-3476420 CGGCGGGGGTGGGGGCCTCTTGG + Intronic
1133225082 16:4337122-4337144 CAGTGGGGGTGGGGGGGGCATGG + Exonic
1133452040 16:5911839-5911861 CCATGGGGGTGGGGCCCTCATGG - Intergenic
1133769210 16:8858119-8858141 ATGTGAGGCTGGGGGCGACACGG - Intronic
1133819965 16:9227265-9227287 CTGCGGGGGTGGGGGTAAAATGG + Intergenic
1134476096 16:14575115-14575137 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1136116428 16:28097617-28097639 CAGGGGGAGTGGGTGCCACAGGG + Intergenic
1136240242 16:28938921-28938943 CTGGGGAGGAGGGGGCCGCATGG + Exonic
1136736854 16:32474303-32474325 CTGGCGGGGTGACGGCCACAGGG + Intergenic
1136777973 16:32881718-32881740 CGGTGGGGGTGATGGGCACAGGG + Intergenic
1136892649 16:33979796-33979818 CGGTGGGGGTGATGGGCACAGGG - Intergenic
1137444229 16:48522138-48522160 CTTTGGGGTTGGGGGCCATCTGG + Intergenic
1137554440 16:49461698-49461720 GGGTGGAGGTGGGGGCCACAGGG + Intergenic
1137607350 16:49795654-49795676 CTGTGGGGGCGGGGCCTCCAAGG - Intronic
1137671790 16:50283606-50283628 CTGTGGGGAAGGTGTCCACATGG - Intronic
1137761786 16:50946983-50947005 CTGTGGGGATGGGGGGCTCAGGG + Intergenic
1138198466 16:55071672-55071694 CTGTAGGGGTGGGGCCTTCATGG - Intergenic
1138806786 16:60099867-60099889 CTGGGGCAGTGGTGGCCACAGGG - Intergenic
1139036157 16:62948964-62948986 TTGTGGAGGAGGGGGCCACAGGG - Intergenic
1139291972 16:65867591-65867613 GTGTGGGGGTGGGGGCTGGAGGG - Intergenic
1139545370 16:67647380-67647402 CTGAGGGGGTGAGGGGGACAGGG + Exonic
1139636989 16:68264015-68264037 TTGTGGGTGCGGGGGCCTCAAGG + Intergenic
1139812751 16:69636482-69636504 CTGCAGGGGTGGGGCCCTCACGG - Intronic
1139951946 16:70676856-70676878 CAGTGGGGGTGGGGTTCCCAGGG - Intronic
1139953933 16:70684630-70684652 CTGTGGGGGTGGGGGCCCTTGGG + Intronic
1140457370 16:75113132-75113154 GCTTGGGGGTGGGAGCCACAGGG - Intronic
1141214224 16:82009160-82009182 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1141227317 16:82130181-82130203 CTGTGGTGGCGGAGGCCACAGGG - Intergenic
1141638409 16:85327942-85327964 ATCTGGGGGTGGGGGGCACCAGG - Intergenic
1142007461 16:87696308-87696330 CTCAGGGTGTCGGGGCCACAAGG + Intronic
1142286491 16:89173513-89173535 TGGTGGAGGTGGGGGCCAGATGG + Intronic
1203016215 16_KI270728v1_random:355274-355296 CTGGCGGGGTGACGGCCACAGGG - Intergenic
1203034550 16_KI270728v1_random:628432-628454 CTGGCGGGGTGACGGCCACAGGG - Intergenic
1203080391 16_KI270728v1_random:1143827-1143849 CGGTGGGGGTGATGGGCACAGGG + Intergenic
1142875929 17:2852340-2852362 GGGTGGGGGTGGGGGGCACAAGG + Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143020323 17:3914260-3914282 CTGTGGGGCTCAGGACCACAGGG - Intronic
1143030221 17:3963667-3963689 GGGTGGGGGTGGGGGCCCCAAGG + Intronic
1143135445 17:4710242-4710264 CAGTGGCGGTGGGGGCGACCGGG - Intergenic
1143413754 17:6729467-6729489 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1143584408 17:7844142-7844164 CTTGGGGGGCGGGGGCCACGTGG + Intronic
1143625820 17:8109697-8109719 CTGCGGGGGCGGGGGAGACAGGG + Intronic
1144640004 17:16931818-16931840 ATCTGAGGGTGGTGGCCACAGGG - Intronic
1144829761 17:18124603-18124625 CTGGGAGGGTGGGGACCCCATGG - Intronic
1145266902 17:21384000-21384022 CTCTGGGGGTGGGGGAGGCAGGG - Intronic
1145799310 17:27672958-27672980 CTGTGCAGGTGTGGGCCACTGGG - Intergenic
1147321953 17:39651951-39651973 CTGTAGGCCTGGGGGCTACATGG + Intronic
1147326116 17:39670405-39670427 CCAGGTGGGTGGGGGCCACAGGG - Exonic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148124067 17:45228032-45228054 ATGGGGGGCTGGGGGACACACGG - Intronic
1148629070 17:49092615-49092637 GGGCGGGGGTGGGGGGCACATGG + Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148895490 17:50836841-50836863 TGATGGGGGTGGGAGCCACAGGG + Intronic
1149052693 17:52325560-52325582 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1149108567 17:52997954-52997976 CTGGGGTGGTGGTGGCTACAGGG + Intergenic
1149147266 17:53509851-53509873 CTTTGGAGATGGGAGCCACATGG - Intergenic
1149540217 17:57462993-57463015 CTGTGGTGGAAGGGGCCCCATGG - Intronic
1149896603 17:60433207-60433229 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
1151419061 17:73985558-73985580 CTGTGAGGATGGGGGTCACATGG + Intergenic
1151658659 17:75507552-75507574 GGGTGGGGGTCGGGGGCACATGG + Intronic
1151858213 17:76737743-76737765 CTGAGGGGGCCGGGGTCACAGGG - Exonic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152492740 17:80648690-80648712 ATTTGGGGGTGGGGGGCACAAGG - Intronic
1152632162 17:81415152-81415174 CTCAGAGGGTGGGGGTCACACGG - Intronic
1152699230 17:81810953-81810975 CTGTGGGGGGGGCGGGCCCAGGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152844874 17:82593564-82593586 CTGTGGGGCCGGGAGCCAGAAGG - Intronic
1152967446 18:129906-129928 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1152982348 18:290336-290358 CTGTCGGGGTGGGGGGCAAGAGG + Intergenic
1153074708 18:1148898-1148920 CTGTGGTAGTGGTGGCCTCAGGG + Intergenic
1153921027 18:9790226-9790248 TTGTGGGGGTAGGGGGTACAGGG + Intronic
1154122143 18:11660730-11660752 CTGTGTGGGTGGCGGCGCCACGG + Intergenic
1154926536 18:20942143-20942165 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1154977559 18:21474439-21474461 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1155675655 18:28425863-28425885 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1156179204 18:34583323-34583345 GTTTGGGGGTGGGGGCCAACGGG - Intronic
1156467581 18:37357482-37357504 CTGTAGGGATGGGGTCCTCATGG + Intronic
1156809082 18:41225055-41225077 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1157065210 18:44341737-44341759 CTCTGGTGGTGGTGGCCACGAGG - Intergenic
1158335821 18:56414323-56414345 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1158709552 18:59825147-59825169 CTGTGGTGGCAGTGGCCACAGGG - Intergenic
1159022556 18:63155498-63155520 CTGCTGGGGTGGAGGCCACAGGG + Intronic
1159410869 18:68073159-68073181 CTGTAGGGGTGGGGCTCTCATGG + Intergenic
1159415129 18:68137314-68137336 CTGTGGGGGTGTGGTGGACAAGG - Intergenic
1159425133 18:68275383-68275405 CTTGGGGGGTGGGGGCGGCACGG - Intergenic
1159705440 18:71679964-71679986 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1159731328 18:72032514-72032536 ATGTTGTGGTGGCGGCCACAGGG - Intergenic
1159802532 18:72919354-72919376 CTAGGGTGGTGGTGGCCACAGGG - Intergenic
1160696733 19:488708-488730 CTGCGGGGGTCGGGGCCGCAGGG - Intergenic
1160744285 19:703583-703605 GGGTTGGGGTGGGGGCCATAAGG + Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1160843745 19:1157570-1157592 TTGGGGGGGCGGGGGTCACACGG + Intronic
1160984392 19:1831497-1831519 GGGTGTGGGTGGGGGCCATAGGG - Intronic
1161059657 19:2208523-2208545 GCGTGGAGGTGGGGGCCGCACGG - Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161295843 19:3519870-3519892 CTGTGGGTGTGGGGCCCCCCGGG - Intronic
1161295862 19:3519945-3519967 CTGTGGGTGTGGGGCCCCCCGGG - Intronic
1161307214 19:3574637-3574659 CTTTGGGGGTCGGGGCTACTGGG - Intronic
1161351963 19:3798370-3798392 GGGTGGGGGTGGGGGTCACTGGG + Intronic
1161357252 19:3826017-3826039 TTGTGGGGTTGGGGGGTACAGGG - Intronic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1162256736 19:9496594-9496616 AGGTGGGGGTGGGGGGGACAGGG + Intronic
1162327920 19:10009608-10009630 GGGTGGGGGAGGGGGCAACAGGG + Intronic
1162480610 19:10924857-10924879 CTGGGGTGGAGGCGGCCACATGG - Intronic
1162524503 19:11199571-11199593 CTATGGAGTTGGGGGCCCCATGG - Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163160554 19:15461542-15461564 CGTTGGGTGTGGGGGCCTCAGGG + Exonic
1163823366 19:19509075-19509097 CTGTGGGGATGGAGTCCCCACGG + Intergenic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1165096950 19:33414575-33414597 GTGGGCGGGTGGGGGCCACCTGG - Intronic
1165247207 19:34504617-34504639 CTGTGTGGGGAGGGGCCACTGGG + Exonic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1166109354 19:40613094-40613116 CAGTGGCCGTGGGGACCACAGGG - Exonic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
1166292442 19:41871749-41871771 ATGTGGGGGAGTGAGCCACAAGG - Exonic
1166756035 19:45192186-45192208 CTGGGGCAGTGGTGGCCACAGGG - Intronic
1166949448 19:46416689-46416711 TGGTGGGGGTGGGGGCGCCACGG + Intergenic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167216552 19:48169711-48169733 CTGAGGGGGCGGGGGCCACCTGG - Intronic
1167902595 19:52633197-52633219 GGGCAGGGGTGGGGGCCACAAGG - Intronic
1168132731 19:54331673-54331695 CTGTGGGAGAGGAGACCACAGGG + Intergenic
1168191286 19:54740445-54740467 CTGTGTGTGCGGGGGTCACAGGG - Intronic
924966053 2:77341-77363 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
925035963 2:686018-686040 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
925435924 2:3837523-3837545 TTCTGGGGGTGGGGGGCCCATGG + Intronic
925443524 2:3908410-3908432 CTGTAGGGGTGGGGATCTCATGG - Intergenic
925494839 2:4435382-4435404 CTGCGGGGGTGGAGCCCTCATGG - Intergenic
925669180 2:6293176-6293198 CTGTCGGGGTGGGGTCCTCATGG + Intergenic
925805145 2:7641188-7641210 CTGAAGGGGTGGGGCCCTCATGG - Intergenic
926160956 2:10489003-10489025 ATGTGGGGGTGGGGGACACGGGG - Intergenic
926516318 2:13851020-13851042 CTGGGGTGGTGGTGGCCACAGGG + Intergenic
926834111 2:16998872-16998894 CTGTAGTCGTGGTGGCCACAGGG - Intergenic
927570216 2:24152958-24152980 CAGTGGTGGTGGTGGCCACAGGG - Intronic
927715865 2:25352267-25352289 TTGTCGGGGAGGGGGCAACAGGG + Intergenic
927758359 2:25727102-25727124 CTGTTGGGGTCGGGGGCAGAGGG - Intergenic
928098815 2:28423006-28423028 GGGTGGGGGTGGGGGCCCTAAGG - Intergenic
928275580 2:29897508-29897530 GTGGTGGGGTGGGGGCCCCAGGG + Intronic
928484158 2:31712323-31712345 CTGGGGTGGTGGTAGCCACAGGG + Intergenic
928715486 2:34055662-34055684 CTGGGGTCGTGGTGGCCACAGGG - Intergenic
928750627 2:34466709-34466731 CTGTGGGGGTGGGATCCACTGGG - Intergenic
928853851 2:35781415-35781437 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
928885505 2:36143707-36143729 CTGTGAGACTGGGGGCAACAGGG - Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
930404866 2:50942255-50942277 CTGTGGGAATGGAGCCCACATGG + Intronic
930675381 2:54195569-54195591 CTGGGGCTGCGGGGGCCACATGG - Intronic
930970248 2:57386181-57386203 CTGTGAAGGTAGTGGCCACAGGG + Intergenic
931033492 2:58211131-58211153 CTGCAGGGGTGGGGCCCTCATGG - Intronic
931145068 2:59508255-59508277 CTGAAGGGGTGGGGCCCTCATGG + Intergenic
931154685 2:59614873-59614895 CTGTAGGGGAGGGGTCCTCATGG - Intergenic
931600799 2:64001143-64001165 CTTTGGTGGTGGTGGCCACAGGG - Intronic
931802757 2:65774503-65774525 ATATGGGGGCGGGGGCCCCAAGG - Intergenic
932211773 2:69937425-69937447 CTCTGGGGTTGGGGAGCACAAGG - Intronic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932485487 2:72081959-72081981 GTGTGGGGGTGGGGGCAGCAGGG - Intergenic
932847592 2:75151594-75151616 CTGCAGGGGTGGGGCCCTCATGG + Intronic
932858737 2:75266657-75266679 CTGTGGTGGTCATGGCCACAAGG - Intergenic
932935667 2:76098445-76098467 CTGTGGGGGCAGGGCCCTCATGG - Intergenic
933166116 2:79077883-79077905 CTCAGGGGGTGGGGACCAAAAGG - Intergenic
933689979 2:85172306-85172328 GTGTGGGGGTGGTGGCCACAGGG - Intronic
934308609 2:91844530-91844552 CTGGCGGGGTGACGGCCACAGGG - Intergenic
935751001 2:106233572-106233594 CAGTGGTGGTGGTGGCTACAGGG + Intergenic
936543904 2:113373893-113373915 CTGCAGGGGTGGGGACCTCATGG - Intergenic
936549800 2:113427386-113427408 CTGTAGGGGTGGGTCCCTCATGG + Intergenic
936831590 2:116654176-116654198 TTGTGGTGGTGGTGGCCACAGGG + Intergenic
937341549 2:121094449-121094471 GGGTTGGGGTGGGGGGCACAAGG + Intergenic
937347065 2:121132601-121132623 CTGTGGGGGTTGGGGGTGCAGGG + Intergenic
937449011 2:121985040-121985062 CTGTGAGGGTGGAGCCCTCATGG + Intergenic
937985562 2:127636645-127636667 CGGAGGGGCTGGGGGCCACCAGG + Intronic
938305940 2:130253964-130253986 CTATGGCGATGGGGGCCACATGG + Intergenic
938423787 2:131167249-131167271 CTGTCGGGGTGGGGGGCAAGTGG - Intronic
938448214 2:131393807-131393829 CTATGGCGATGGGGGCCACATGG - Intergenic
938952333 2:136266690-136266712 CTGTGCGGGTGGGATCCACTTGG + Intergenic
939144567 2:138396738-138396760 CTGAGGTTGTGGTGGCCACAGGG + Intergenic
939256563 2:139751188-139751210 TTGTGAGGGTGGGGCCCTCATGG - Intergenic
939405019 2:141745446-141745468 CTGTGGTGGTGGTGGCCATAGGG - Intronic
939667537 2:144969490-144969512 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
939762423 2:146199155-146199177 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
940054547 2:149500151-149500173 CTGTGGGGGTGGGACCCGCTGGG + Intergenic
940468713 2:154065108-154065130 CTGTGGCAGTGGGGACCACAGGG + Intronic
940560389 2:155288034-155288056 CTGTGGTGGTGTTGTCCACAAGG + Intergenic
940795448 2:158072207-158072229 CAGTGGTGGTGGTGGCCACTGGG + Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
940982951 2:160023876-160023898 TGGTGGGGGTGGGGGCAGCAAGG - Intronic
941346253 2:164372641-164372663 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
941490634 2:166138636-166138658 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
941672528 2:168310370-168310392 CTGTGGTGGCAGTGGCCACAGGG - Intergenic
941741906 2:169044330-169044352 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
941754736 2:169173078-169173100 CTGTGGTAGGAGGGGCCACAGGG - Exonic
942053692 2:172163212-172163234 CTTTGGGGATGTGGGACACAGGG + Intergenic
942136596 2:172931975-172931997 GGGTGGGGGTGGGGGGCGCATGG - Intronic
942601354 2:177644031-177644053 CTGCAGGGGTGGGGCCCTCATGG + Intronic
942834464 2:180277237-180277259 CTGTGGCAGTGGTGGCCACAGGG - Intergenic
942950100 2:181712325-181712347 CAGAGGGGGTGGGGCCCTCATGG + Intergenic
943017305 2:182528957-182528979 CTGCTGGGGTGGGGCCCTCATGG + Intergenic
943072188 2:183153875-183153897 CTGCAGGGGTGGGGCCCTCATGG - Intronic
943193961 2:184719000-184719022 CTGTAGGGATGGGGCCCTCATGG - Intronic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
943967416 2:194354395-194354417 CTCAGGTGGTGGTGGCCACAGGG + Intergenic
944303955 2:198157783-198157805 CTGCAGGGGTGGGGCCCTCATGG + Intronic
944751946 2:202718049-202718071 CTGTGGTAGTGGTGGCTACAAGG - Intronic
945048893 2:205805365-205805387 GTGTTGGGGAGGGGACCACAGGG - Intergenic
945575699 2:211525823-211525845 CTGTAGTGGTGGTGACCACAGGG + Intronic
946108235 2:217390904-217390926 CTGCAGGGGTGGGGCCCTCATGG - Intronic
946370583 2:219279310-219279332 CTGGGGGGGTGGGGGCCTGCAGG - Exonic
946709562 2:222492268-222492290 CTGCAGGGGTGGAGGCCTCATGG - Intronic
946844907 2:223850573-223850595 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
947687077 2:232097508-232097530 CTGTAGTGGTGGCAGCCACAGGG - Intronic
947951628 2:234152713-234152735 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
948176259 2:235945891-235945913 CGGTGGTGGTGGGGGCGATATGG + Intronic
948180772 2:235978273-235978295 GTGGGTGGGTGGGGGCCACAGGG - Intronic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948528366 2:238587424-238587446 CTGTGGGGGAGGGGGGACCAAGG + Intergenic
948813754 2:240499395-240499417 ATGTGGGGGTGGGGGTGACCAGG + Intronic
948815242 2:240507267-240507289 GTCTGGGGGTGGGGTCCTCATGG - Intronic
948846904 2:240687610-240687632 CTGTGGGTGGGGGGTGCACACGG + Intergenic
948860058 2:240748468-240748490 CTGTCAGGGTGGGGGCCAGTGGG + Intronic
949080967 2:242099368-242099390 CAGTGGGGCTGTGGGCCGCATGG - Intergenic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1169081231 20:2798759-2798781 CTGCTGGAGTGGGGGTCACAAGG + Exonic
1170079019 20:12450842-12450864 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1170668446 20:18406934-18406956 CAGTAGTGGTGGTGGCCACAGGG + Intronic
1170737567 20:19025018-19025040 CTGTGGGGGTGGGGCCCAAGTGG - Intergenic
1171118694 20:22549495-22549517 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1172082162 20:32350663-32350685 CTGTTGGGTCTGGGGCCACAGGG + Intergenic
1172633543 20:36394382-36394404 CTGTGGGGGTGTGAGCTGCAGGG + Intronic
1172975960 20:38906114-38906136 CTGTGGGGGAGGCCGGCACAGGG + Intronic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173537827 20:43829473-43829495 CCCTGGAGGTGGGGACCACATGG + Intergenic
1173944360 20:46938782-46938804 CTGTGTGGGAGGGGACTACACGG + Intronic
1174447065 20:50597531-50597553 CGGTGGGAGTGGTGGCCACTGGG + Intronic
1174618575 20:51856020-51856042 CAGTGGGGGTGGGGTCTGCAAGG + Intergenic
1175195684 20:57241746-57241768 ATGTTGGGGTAGGGGCCAGAGGG + Intronic
1176127335 20:63481892-63481914 CTGGGGAGGGCGGGGCCACAGGG + Intergenic
1176129539 20:63490850-63490872 GCCTGGGGGTTGGGGCCACATGG + Intronic
1176144452 20:63559371-63559393 CTGTGAGGGTGGGAGTCAGATGG + Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176180176 20:63746224-63746246 CTGAAGTGGTGGGGGGCACAGGG + Exonic
1176235281 20:64050921-64050943 CTGTGGGGGTGCTGGCCTCAGGG - Intronic
1176359554 21:5983291-5983313 GGGTGGAGGTGGGAGCCACAGGG - Intergenic
1176386253 21:6139850-6139872 CTCTGGGGGAGGTGACCACAGGG + Intergenic
1176783419 21:13226793-13226815 CTGCAGGGGTGGGGCCCTCAGGG + Intergenic
1177118137 21:17109997-17110019 CTGCAGGGGTGGGGTCCTCATGG - Intergenic
1177317442 21:19479346-19479368 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1177456367 21:21344505-21344527 CTGGGGTGGTGGTGGCTACAGGG + Intronic
1177782907 21:25639561-25639583 GTGTGGGGGTAGGGGCTAGAGGG - Exonic
1177839298 21:26218355-26218377 CTGTAGGGGAGGGGCCCTCATGG + Intergenic
1177981063 21:27915560-27915582 CTGCAGGGGTGGGGCCCTCAGGG + Intergenic
1178224483 21:30699634-30699656 CTGTGGGAGTGAGGCCCTCATGG - Intergenic
1178393547 21:32219678-32219700 CTGTGGGGGTGGGATCCTCTGGG - Intergenic
1178634211 21:34288225-34288247 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1178680934 21:34670979-34671001 CTTTGGGGGTGGGGGCGACGGGG + Intronic
1178711507 21:34921292-34921314 CTGTGGGGGAGGGGGAAACAGGG - Intronic
1179109869 21:38437331-38437353 AGGTGGGGGTGGGGGCTGCAGGG + Intronic
1179737220 21:43398402-43398424 CTCTGGGGGAGGTGACCACAGGG - Intergenic
1179763964 21:43555259-43555281 GGGTGGAGGTGGGAGCCACAGGG + Intronic
1179936689 21:44610543-44610565 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1180093146 21:45542687-45542709 CGGCGGGGGTGGGGGCCCGAGGG - Intronic
1180095017 21:45552423-45552445 CTGTTGGGTCGGGGGCCCCAGGG + Intergenic
1180187460 21:46146504-46146526 CTGCTGGGGCGGGGCCCACAGGG - Intronic
1180197770 21:46207833-46207855 CAATGGGGGTGGGGGGCACCTGG - Intronic
1180199600 21:46216335-46216357 CTCTGGGGCTGGGACCCACAGGG - Intronic
1180246917 21:46554632-46554654 CTGAGGGTGCGGGGGCCGCACGG - Exonic
1180251404 21:46592534-46592556 CTGCAGGGGTGGGGCCCTCACGG + Intergenic
1180535695 22:16391609-16391631 CTGGCGGGGTGACGGCCACAGGG - Intergenic
1180906131 22:19413254-19413276 AAATGGGGGTGGGGGCCTCAAGG + Intronic
1181003907 22:20000492-20000514 ATGTGGCGGTGGGAGCCAGATGG - Intronic
1181049751 22:20232928-20232950 CTGCAGGTGTTGGGGCCACAGGG - Intergenic
1181166623 22:20987440-20987462 CTGTGGGGGTGTGGACCTCATGG + Intronic
1181463061 22:23096630-23096652 CTCAGGGTGTGGAGGCCACAGGG + Intronic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1181716930 22:24737825-24737847 CTGTGGTGGTGGTGGCCATGGGG + Intronic
1182510593 22:30817334-30817356 ATGAGGGGCTGGGGCCCACAGGG - Intronic
1182737713 22:32542945-32542967 CTGTCGGGGTGAGGGTGACAGGG - Intronic
1182797817 22:33004127-33004149 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1182813513 22:33137887-33137909 CTGTAGGGGTGGGGTCCTCATGG + Intergenic
1182815190 22:33156098-33156120 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
1183225777 22:36548969-36548991 CTGTGCGGGTCAGCGCCACACGG + Intergenic
1183303778 22:37071189-37071211 CTGTGGGGGGCGGGGGGACATGG - Intronic
1183367932 22:37417082-37417104 CTGTGTTGGTGGCGGCCACGTGG - Intronic
1183539773 22:38423298-38423320 CACTGGGGGAGGGGGCCACGCGG - Intergenic
1183705520 22:39472959-39472981 CTTGGGGAGTGTGGGCCACAGGG + Intronic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
1184399971 22:44267995-44268017 CTTTGGGAGTGGGGTCAACAGGG + Intronic
1184615169 22:45633038-45633060 CTGTGGGGGCGGGGGAGACAGGG + Intergenic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
1184839134 22:47042341-47042363 CTGTGGCAGTGGGGGCGCCATGG + Intronic
1184963244 22:47947065-47947087 CTCTGGGGGTGGGAGCACCAAGG - Intergenic
1185017414 22:48352814-48352836 CTCTGGGGATGGGAGGCACATGG - Intergenic
1185148817 22:49152933-49152955 CTGGGGGGATGGGGGCCCCTAGG + Intergenic
1185371146 22:50461479-50461501 CTGGGGGAGAGGGGGCGACAGGG + Intronic
1185404695 22:50641271-50641293 CTGTGTGGCTGAGGGCCCCAAGG + Intergenic
949662163 3:6291866-6291888 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
949733704 3:7145759-7145781 CTGTCTGAGTGGAGGCCACAAGG - Intronic
949829206 3:8196584-8196606 CTGGGGTGGTGGTGGCCACAGGG - Intergenic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950244993 3:11407567-11407589 CTGTAGGGGTGGGGTCCTCATGG - Intronic
950566379 3:13772142-13772164 GGGTGGGGGCGGGGGCCAGAGGG + Intergenic
950589323 3:13924930-13924952 CTGCAGGGGTGGAGCCCACATGG + Intergenic
950645203 3:14372898-14372920 ATGTGGGGGTGGGGAGCACCAGG - Intergenic
951180669 3:19654833-19654855 CTGCAGGGGTGGAGCCCACATGG - Intergenic
951192526 3:19786799-19786821 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
951259866 3:20495169-20495191 CAGTGGTGGTGGCGGCCACAGGG - Intergenic
951452194 3:22852279-22852301 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
951512702 3:23521882-23521904 CTGGGGGGGTGGGGGGTACACGG - Intronic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
951558506 3:23944839-23944861 GGGTGGGGGTGGGGGGCGCAAGG + Intronic
951936108 3:28024800-28024822 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
952222011 3:31332477-31332499 CTGTGGTGGTGGTGGCCATAGGG + Intergenic
952480212 3:33753696-33753718 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
952566881 3:34669432-34669454 CTGTGGTAGTGGTAGCCACAGGG + Intergenic
953362355 3:42309262-42309284 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
954132669 3:48568350-48568372 CTGTGGAGGTGGGGGACCCTGGG + Intronic
954302424 3:49706972-49706994 CTGAGAGGGTGGGGGCATCAAGG - Intronic
954374666 3:50188010-50188032 CCCTGGGGCTGGGGGGCACATGG - Exonic
954648686 3:52146459-52146481 TTGTTGGGCTGGGAGCCACAAGG - Intronic
954704034 3:52469270-52469292 ATGTGGGGGTGGGGGGCTGAGGG + Intronic
954877057 3:53809087-53809109 CTCAGGGAGTGGGGGCCACTTGG + Intronic
954880220 3:53830838-53830860 CTGTGGGGGTGGGGGGCGAGGGG - Intronic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
955465244 3:59230311-59230333 CTGTAGGGTTGGGGTCCTCATGG - Intergenic
955538669 3:59951608-59951630 ATGGTGGGGTGGGGGGCACAAGG - Intronic
955753296 3:62203817-62203839 CTGTGGCGGTGGGGGGCACTTGG - Exonic
956157349 3:66312420-66312442 CTGTGGGGGTGGAGCCTACTGGG + Intronic
956503273 3:69910320-69910342 CTATAGGGGTGGGGCCCTCATGG + Intronic
956558796 3:70551005-70551027 CTGTAGGGCTGGGGTCCTCATGG - Intergenic
957026300 3:75186200-75186222 TTTTGGGGGTGGGGTCAACACGG - Intergenic
958154097 3:89730770-89730792 CTGCAGGGGTGGAGCCCACATGG + Intergenic
958609783 3:96410395-96410417 CTGCTGGGGTGGAGCCCACATGG - Intergenic
958611882 3:96436672-96436694 CTGCAGGGGTGGGGTCCTCATGG - Intergenic
958860262 3:99437247-99437269 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
958876733 3:99625080-99625102 CTGTGGTGGCAGTGGCCACAGGG + Intergenic
959512890 3:107233853-107233875 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
960564968 3:119123225-119123247 CTGTGGTGGTAGCGGCCACAGGG + Intronic
960881264 3:122347992-122348014 CGGTGGAGGTGGGAGTCACAAGG - Intergenic
960972557 3:123150234-123150256 CTGGGGGCGGGGGGGCCTCAGGG - Exonic
961270372 3:125683393-125683415 CTGTGGGGGCTGGGGCCTGAAGG + Intergenic
961290219 3:125840763-125840785 CTGGAGGGCTAGGGGCCACATGG - Intergenic
961358077 3:126351475-126351497 CTGTGGGGCTGTGGGCCCAAAGG + Intronic
961390937 3:126551963-126551985 CAGTGGGGGTGGTGGCATCAGGG + Intronic
961679433 3:128589284-128589306 GTGTGGGGGCAGGGGGCACATGG - Intergenic
961750880 3:129093955-129093977 CTGTTGGGGTGAGGACCCCAGGG + Intronic
961952354 3:130762854-130762876 CTGTGGTGGTAGTGGCTACAGGG + Intergenic
961961986 3:130864846-130864868 CTGCAGGGGTGGGGTCCTCATGG + Intronic
962170779 3:133099048-133099070 CTGCAGGGGTGGGGCCCTCATGG - Intronic
962191172 3:133312516-133312538 CTGTGGGTGTGGGACCCACCAGG + Intronic
962211486 3:133482846-133482868 CTGTTGGGGTGGGGGGCGCTGGG + Intergenic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
963022531 3:140886107-140886129 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
963231238 3:142910566-142910588 TTGTTGAGGTGGGAGCCACAAGG - Intergenic
963280876 3:143383827-143383849 CTGTTGGGGTGGGGGAAGCAAGG + Intronic
963418362 3:145027717-145027739 CTGTAGGGGTGGGGTCCTCATGG + Intergenic
963422073 3:145073277-145073299 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
964088541 3:152846978-152847000 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
964179457 3:153865702-153865724 CAGTGGTGGTGGTGGACACAGGG + Intergenic
964961101 3:162427711-162427733 CTGTGGTGGTCACGGCCACAGGG + Intergenic
965250875 3:166342585-166342607 CTGTGGTGATGGTTGCCACAGGG + Intergenic
965415134 3:168384136-168384158 CTGTGGTGATAGTGGCCACAGGG - Intergenic
966055260 3:175679038-175679060 TGGTAGGGGTGGGGGTCACAAGG + Intronic
966074395 3:175919327-175919349 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
966491134 3:180529733-180529755 CTGGGGTGGTGGTGGCTACAAGG + Intergenic
966741994 3:183242631-183242653 CTGCAGGGGTGGGGCCCTCATGG + Intronic
967451112 3:189624307-189624329 TTATGGGGGTGGGGGTGACAGGG - Intergenic
967957305 3:194887078-194887100 CTGGAGGGGTGGAGGCCTCATGG - Intergenic
968175936 3:196549523-196549545 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
968265584 3:197360529-197360551 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
968616221 4:1578997-1579019 CTGCGGGGGTGGGGGGCCTAGGG - Intergenic
968689309 4:1982525-1982547 CTGTGGGCCTGGGGACCACCCGG - Intergenic
968818232 4:2832659-2832681 CTGGGGTGGCGGAGGCCACATGG + Intronic
968958370 4:3730461-3730483 CAGTGGGGGCTGGGGGCACAGGG + Intergenic
968958432 4:3730599-3730621 CGGTGGGGATTGGGGGCACAGGG + Intergenic
968958472 4:3730689-3730711 CAGTGGGGGCTGGGGCCCCAGGG + Intergenic
969194643 4:5551042-5551064 CTGCAGGGGTGGGGCCCTCATGG + Intronic
969993045 4:11283854-11283876 CTATGGGGGTGGGGGTCTCATGG - Intergenic
970226570 4:13864544-13864566 GTGTGGGGGTGGGGGATACATGG - Intergenic
970339134 4:15086179-15086201 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
970361271 4:15310960-15310982 CTGCAGGGGTGGGGCCCTCAGGG + Intergenic
970413367 4:15832994-15833016 CTGTGGTGGTGGTGGCCATGAGG - Intronic
970424489 4:15933748-15933770 ATGTGGAGGAGGGGGCCACAGGG + Intergenic
970442494 4:16093714-16093736 CAGTGGTGGTGGTGGCCACAAGG + Intergenic
970497039 4:16636679-16636701 ATGTGGGGGTGGGGGACAAGAGG + Intronic
970554205 4:17215097-17215119 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
970742069 4:19250686-19250708 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
970801317 4:19976420-19976442 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
970805351 4:20024376-20024398 CTGTGGGTGTGGGGACCCCAAGG - Intergenic
970806289 4:20038061-20038083 CTGGGAGGGTGAGGGGCACATGG - Intergenic
971428672 4:26541122-26541144 CTGTCGGGGTGGGGGACAAGGGG + Intergenic
971600191 4:28582261-28582283 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
972009498 4:34158891-34158913 TGGTGGTGGTGGTGGCCACAGGG + Intergenic
972033657 4:34493786-34493808 CTACTGGGGTGGGGGCCTCATGG + Intergenic
972057840 4:34826661-34826683 CTGTAGGGCTGGGGTCCTCAAGG - Intergenic
972485199 4:39534009-39534031 CTGTAGGGGTGGGGCCTTCATGG + Intergenic
972492220 4:39598830-39598852 ATGGGGGTGTGGGGGTCACATGG - Intronic
972739602 4:41877812-41877834 GGGTGGGAGTGGGGGCCAAAAGG - Intergenic
972849857 4:43035583-43035605 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
972887492 4:43510238-43510260 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
973213039 4:47637738-47637760 CTGCAGGGGTGGGGCCCTCATGG + Intronic
973552351 4:52048423-52048445 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
973919754 4:55673284-55673306 CTGCGGTGGTGGTGGCCACAGGG - Intergenic
974171278 4:58270177-58270199 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
974202227 4:58656844-58656866 CTCTAGGGGTGGGGGCCTCATGG + Intergenic
974253415 4:59419683-59419705 TTGTGGGGGTGGTGCCCAGATGG + Intergenic
974271367 4:59655670-59655692 ATGTGGGGGTGGGGCCGAGATGG + Intergenic
974430580 4:61791678-61791700 CTGCAGGGGTGTGGCCCACATGG - Intronic
974872510 4:67660609-67660631 CTGCAGGGGTGGGGCCCTCATGG + Intronic
974991574 4:69097429-69097451 CTGTGTGAGTGATGGCCACAGGG - Intronic
975365528 4:73523869-73523891 CTGTGGTGGTGGTGGCCATAGGG - Intergenic
975369450 4:73568014-73568036 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
975506999 4:75148713-75148735 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
976214574 4:82704254-82704276 CTGTGTGTCTGAGGGCCACAGGG + Intronic
976451814 4:85199396-85199418 CTGTGGTGGTGGTGGATACAGGG - Intergenic
976672924 4:87673920-87673942 CTGCAGGGGTGGGGCCCCCATGG - Intergenic
976875596 4:89850269-89850291 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
977197865 4:94084043-94084065 CTGCAGGGGTGGGGTCCTCATGG - Intergenic
977417270 4:96749276-96749298 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977503929 4:97878372-97878394 CTGCAGGGGTGGGGCCCTCATGG - Intronic
977988539 4:103414952-103414974 CTGTAGGGGTGGGGTCCTCAGGG + Intergenic
978112463 4:104978935-104978957 CTGTGGTAGTGGTGGCCACAGGG + Intergenic
978201596 4:106029064-106029086 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
978638234 4:110837569-110837591 GGGTGGGGGTGGGGACCAGAAGG + Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978934552 4:114359260-114359282 CTGTGTTGGTGGTGGACACAGGG - Intergenic
979390103 4:120117915-120117937 CTGTAGGGGTGGGGTCCTCATGG - Intergenic
979984365 4:127295852-127295874 TTGTAGGGGTGGAGCCCACATGG - Intergenic
980052328 4:128050950-128050972 GTGTGTTGGTGGGGGACACATGG + Intergenic
980256047 4:130382190-130382212 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
980509876 4:133771715-133771737 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
980657731 4:135811702-135811724 CTGGTGTGGTGGTGGCCACAGGG + Intergenic
981104448 4:140864622-140864644 CTGTGGGACTGGGGGACACTGGG + Exonic
981298062 4:143156037-143156059 TTGTGGTGGTGGTGGGCACAGGG - Intergenic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
981546470 4:145899264-145899286 CTGTTGGTTTGGGGGCCACCTGG - Intronic
981589290 4:146339972-146339994 CTGTCGGGGTGGGGGACAAGGGG - Intronic
981631804 4:146827346-146827368 CTGTGGGGGCGGGGCCAAGATGG - Intronic
981836919 4:149065046-149065068 CTGGGGTGGTGCTGGCCACAGGG + Intergenic
981861506 4:149361729-149361751 CTGCAGGGGTGGGGCCCTCACGG + Intergenic
981872930 4:149508149-149508171 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
981940509 4:150277267-150277289 TTGTGGGGGTGGGGGCCTAGGGG + Intronic
981975613 4:150723939-150723961 CGGTGGTGGGGGTGGCCACAGGG + Intronic
982030581 4:151296416-151296438 GTGTGGGGGAGGGAGCCACTCGG + Intronic
982098684 4:151947149-151947171 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
982188779 4:152831925-152831947 CTCGGGGGGTGGGGGGCAAAGGG - Intronic
982219511 4:153112529-153112551 CAGTAGGGGTGGGGGCTCCAAGG - Intergenic
982932735 4:161429093-161429115 CTGGGGCAGTGGGGACCACAAGG + Intronic
983460694 4:168022844-168022866 CTGCAGGGGTGGGGCCCTCAGGG - Intergenic
983526248 4:168763019-168763041 CTGTTGGGGTAGGGGGCAAAGGG + Intronic
983936711 4:173507647-173507669 TTCTGGTGGTGGCGGCCACAGGG - Intergenic
984437953 4:179727896-179727918 CTGCAGGGGTGGGGGTCACAAGG - Intergenic
984849461 4:184141426-184141448 CTGTGGGGAAGGCGGCAACAAGG + Intronic
985156029 4:186987969-186987991 CTGCAGGGGTGGGGTCCTCATGG - Intergenic
985183990 4:187296374-187296396 CTGTGGGGGTGGGGCCCTCATGG - Intergenic
985229534 4:187799623-187799645 CTGTGGTGGTGGCAGCCACCAGG + Intergenic
985277456 4:188251762-188251784 CTGTGTAGGAGGGGCCCACATGG + Intergenic
985394322 4:189525751-189525773 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
985622532 5:963014-963036 CCGTGGGTGTGGGGGCCATGTGG - Intergenic
985703269 5:1386273-1386295 CGGCGGGTGTGGGGGGCACAAGG - Intergenic
986012552 5:3729193-3729215 CTGAGGGTGTGGGGGCCCCAGGG + Intergenic
986113917 5:4750543-4750565 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
986218538 5:5744919-5744941 CTGTGGGGTCAAGGGCCACAAGG + Intergenic
986299620 5:6467740-6467762 CTGGGGCGGTGGGGCCCGCAGGG - Intronic
986533612 5:8763655-8763677 CTGTCAGGGGGTGGGCCACAAGG - Intergenic
986756370 5:10840099-10840121 TTGTGGTGGTGGTGGCTACAGGG + Intergenic
986769860 5:10962755-10962777 CTGTAGGTGTGGGGGCGGCAGGG + Intergenic
987182591 5:15384151-15384173 CTGTGGGAGTGAGGCCCACAAGG - Intergenic
987332995 5:16873596-16873618 CTGCAGGGGTGGGGCCCTCATGG - Intronic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
987823156 5:22991742-22991764 CTGTGGTGATGGTGGCTACAGGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988196889 5:28015555-28015577 CTGTAGGGGTGGGGTCCTCATGG + Intergenic
988376280 5:30439666-30439688 CTGGGGCAGTGGTGGCCACAGGG + Intergenic
988426835 5:31074242-31074264 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
988595323 5:32585655-32585677 CTGGGAGGGTGGGGGCCCCGAGG - Intronic
988649436 5:33131929-33131951 CTGAGGGGGTGGGGCCCTCATGG + Intergenic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
988808929 5:34766114-34766136 CTGCAGGGGTGGGGTGCACATGG + Intronic
990578935 5:57150154-57150176 CTGTGGTGGTGGTGGCCATGGGG - Intergenic
990774261 5:59287291-59287313 CTGGGGCAGTGGTGGCCACAGGG + Intronic
990899999 5:60739544-60739566 CTGTGGTGGTGGTGGACACAGGG + Intergenic
990992824 5:61701872-61701894 CTCTGGGGGTGGGGGAAACTGGG - Intronic
991237805 5:64419267-64419289 CTGTGGTGGTGGTGGCCACAGGG + Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
992314400 5:75537270-75537292 GCATGGGGGTGGGGGGCACAGGG + Intronic
992345238 5:75869384-75869406 CTGTGGTGGTAACGGCCACAGGG + Intergenic
992563326 5:77973403-77973425 CTCTGGGAGTGGCGGCGACAGGG + Intergenic
992922383 5:81539889-81539911 CTGTCGGGGTGGGGGGCTAAGGG - Intronic
993098249 5:83505771-83505793 CTGTAGGGGTGGGGCCCTCATGG - Intronic
993257871 5:85616732-85616754 CTATAGGGGTGGAGGCCTCATGG - Intergenic
993410015 5:87562506-87562528 GTCTGGGGGTGGGGGCCAAGGGG - Intergenic
994233926 5:97339764-97339786 CTGTGATGGTGGTGGTCACAGGG + Intergenic
994274660 5:97821811-97821833 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
994660055 5:102642234-102642256 CAGTGGTGGTGGTGGCCACAGGG + Intergenic
994696089 5:103074805-103074827 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
994755613 5:103790379-103790401 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
995312677 5:110731439-110731461 CTGCAGGGGTGGGGCCCTCATGG - Intronic
995333820 5:110976218-110976240 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
995828612 5:116329411-116329433 CTGCAGGGGTGGGGTCCTCATGG - Intronic
996098129 5:119420668-119420690 CTGCAGGGGTGGGGACCTCATGG + Intergenic
996196355 5:120611714-120611736 CTGCAGGGGTGGGGCCCACATGG + Intronic
996886013 5:128354326-128354348 CTGAGGGGGTGGGAGGCACAGGG + Intronic
997492005 5:134285275-134285297 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
997616372 5:135248967-135248989 GTGTGGAGGAGGGAGCCACAAGG + Intronic
997692876 5:135838845-135838867 CTGCAGGGGTGGGGCCCTCATGG + Intronic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
998130843 5:139650395-139650417 ATGCGGGGGTGGGGGGGACAGGG - Intronic
998478983 5:142445522-142445544 CTGTGTGGGTGGGGACCACCAGG - Intergenic
999012309 5:148056260-148056282 CTGTAGGGGTGAGGTCCTCATGG + Intronic
999362758 5:150999641-150999663 CTGTGGGAGTAGGGAGCACAGGG - Intergenic
999473708 5:151878846-151878868 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1000159810 5:158586620-158586642 CTGTGGTGGTGGTGGCTACAGGG - Intergenic
1000226545 5:159266944-159266966 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1000751092 5:165097531-165097553 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1001377246 5:171272867-171272889 TGGTGGTGGTGGGAGCCACAGGG - Intronic
1001531966 5:172469691-172469713 CAGTGGCAGTGGAGGCCACATGG - Intergenic
1003109499 6:3241736-3241758 CTGTTGGGGTGGGGGGCAAGGGG - Intronic
1003572036 6:7262131-7262153 CTGTGGGCGTGGTCACCACAGGG - Intergenic
1003986681 6:11442734-11442756 CTGTAGGGGTGGAGCCCTCATGG + Intergenic
1004245640 6:13972793-13972815 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1005101130 6:22173504-22173526 CTGTTGGGGTGGAGCCCTCATGG + Intergenic
1005284625 6:24312116-24312138 AGGCGGGGGTGGGGGTCACAAGG - Intronic
1005548659 6:26894538-26894560 CTGCGGGGGGGGGGCCCTCATGG + Intergenic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1005950269 6:30626570-30626592 CTGTGGAGTGGGGGCCCACAAGG - Intergenic
1006017675 6:31095127-31095149 TTTTGGGGGTGGGGGACACATGG + Intergenic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1006453737 6:34120357-34120379 CTGTGGGGGTGAGGGAGGCAAGG + Intronic
1006697156 6:35940844-35940866 CTGTAGGGGCGGGGCCCTCATGG + Intergenic
1007339675 6:41182759-41182781 CTGTGGGGAAGGGTGTCACATGG - Intergenic
1007675926 6:43594946-43594968 CTGGGGAGGTGGGGGGCATATGG + Intronic
1007761097 6:44134231-44134253 GTGTGGGGGTGGCGGCGGCAGGG + Intronic
1007887674 6:45249805-45249827 GTGGGGGGGTGGGGGCCAAGGGG + Intronic
1008335456 6:50299016-50299038 CTGTAGAGGAGGGGGCCACTAGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008591094 6:52994808-52994830 CTGTAGGGGTGGTGGACACGCGG - Intronic
1008848471 6:55996233-55996255 CTGGGCTGGTGGGGGCCACAGGG - Intergenic
1009373480 6:62938348-62938370 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1009396246 6:63203727-63203749 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1009478149 6:64121062-64121084 CTATGGGGGAGGGGGGCACATGG - Intronic
1009696875 6:67117504-67117526 CTTGGGGGGTGGGGGCCAAGGGG - Intergenic
1009709677 6:67300760-67300782 CTGTTGGGGTAGGCACCACAGGG + Intergenic
1009732188 6:67622477-67622499 CTGCAGGGGTGGAGCCCACATGG + Intergenic
1009772490 6:68161210-68161232 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1010497309 6:76550312-76550334 CGGTGGGGGTGGGGGCCTAGGGG + Intergenic
1010655630 6:78507830-78507852 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1010838869 6:80623635-80623657 AAGTGGTGGTGGAGGCCACAGGG + Intergenic
1011031098 6:82923561-82923583 CTGTGGGGGTGGGGGGCTAGGGG + Intronic
1011232494 6:85178555-85178577 CTGATGTGGTGGTGGCCACAGGG - Intergenic
1011343765 6:86346679-86346701 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1011950597 6:92959391-92959413 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1012255230 6:97023481-97023503 CTGTGGGGGTGGGAAACACAAGG + Intronic
1013607222 6:111761627-111761649 CTGTGGAGGAGGGAGCCACTTGG - Intronic
1013925519 6:115467700-115467722 TTGTAGTGGTGGTGGCCACAGGG - Intergenic
1014771073 6:125458540-125458562 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1014825692 6:126046683-126046705 CTGTGGGGGAAGGGTCCACTCGG + Intergenic
1014863224 6:126496543-126496565 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1014865200 6:126521025-126521047 CTGTGGTGGAGGTGGCCACAGGG - Intergenic
1015013172 6:128376209-128376231 CTGAAGGGGTGGGGCCCTCATGG - Intronic
1015465247 6:133542047-133542069 CAGTGTGGGAGGGGGCTACATGG + Intergenic
1015954399 6:138584945-138584967 CTGTGTGGGTAAGGACCACAGGG + Intronic
1016122766 6:140364250-140364272 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016177599 6:141099313-141099335 CTGTGGGGGTGGGGTGCGCATGG + Intergenic
1016419999 6:143873522-143873544 CTGCAGGGGTGGGGTCCTCATGG - Intronic
1016424176 6:143916348-143916370 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1016457321 6:144244849-144244871 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1017924764 6:158901391-158901413 CAGTGGTGGTGGTGGCCACATGG - Intronic
1017971363 6:159315247-159315269 CTGTGGGGGTGGGCGCATCACGG + Intergenic
1018466139 6:164047451-164047473 CTGGGGTGGTGGGGCCCTCATGG + Intergenic
1018542527 6:164898035-164898057 CTTTGGGGGTGGGGGAAAAAAGG - Intergenic
1018743680 6:166748545-166748567 CTGAGGAGGTGGGGGCCCAAGGG - Intronic
1018743725 6:166748641-166748663 CTGAGGAGGTGGGGGCCCAAGGG - Intronic
1018866886 6:167753260-167753282 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1019044444 6:169132318-169132340 CAGTGGTGGTGGCGGCCACAGGG + Intergenic
1019050623 6:169180226-169180248 CTGTAGGGGCGGGGCCCTCATGG - Intergenic
1019081637 6:169435241-169435263 CTGCAGGGGTGGGAGCCCCACGG + Intergenic
1019108047 6:169684891-169684913 TTGCTGGGGTTGGGGCCACAGGG - Intronic
1019312637 7:370091-370113 CTGTGGGGGCTGGAGCCCCAGGG + Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1019376226 7:693880-693902 TTGTGGGGGTGTGGGGGACATGG - Intronic
1019499959 7:1359916-1359938 CTGTGGGTGTGGGGCCCACCAGG + Intergenic
1019514492 7:1433756-1433778 CTGGGGGGGTCGGGACCCCACGG - Intronic
1019517148 7:1445073-1445095 CCGTGGGAGTGGGGGCCAGGCGG + Exonic
1019750416 7:2725646-2725668 CTCTGGGAGTGGAGCCCACAGGG - Intronic
1020333395 7:7042339-7042361 CTGTGGGGGTGGGATCCACTGGG - Intergenic
1020782690 7:12536168-12536190 CTGTAGGGATGGGGTCCTCATGG - Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022252392 7:28621190-28621212 GTTGGGGGGTGGGGGTCACAGGG + Intronic
1022514458 7:30966399-30966421 GGGTGGGGGTGGGGGCCATGGGG + Intronic
1022741080 7:33122493-33122515 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1022862529 7:34382974-34382996 CTGTGGGGGTGGGACCCTCATGG + Intergenic
1023641235 7:42261322-42261344 CTATGGGGGTGGGTCCCTCATGG - Intergenic
1024410891 7:49039600-49039622 CTGGGGTGGTGGTGGCTACAAGG + Intergenic
1024546747 7:50528804-50528826 CAGTGGCGGTGGGGGCTGCAGGG - Intronic
1024971869 7:55078591-55078613 TTGTCAGGGTGGGGGCCACACGG + Intronic
1025211608 7:57022338-57022360 CACTGGGGCTGGGGGCCACATGG - Intergenic
1025660348 7:63554489-63554511 CACTGGGGCTGGGGGCCACATGG + Intergenic
1026532586 7:71212396-71212418 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1027626023 7:80545690-80545712 CTCTAGGGGTGGGGTCCTCATGG + Intronic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1028422787 7:90652012-90652034 CTGTGAGGATGGAGGCCACTGGG - Intronic
1028653422 7:93175206-93175228 CTGCAGGGGTGGGGACCTCATGG + Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029133382 7:98350712-98350734 CTGTGGGGTAGGGGGCCTTAGGG - Intronic
1029466763 7:100730472-100730494 AAGTGGGGGTGGGGGGCTCACGG - Intergenic
1029587738 7:101486318-101486340 CTGTGGGGTTGGGGGGGACGTGG - Intronic
1029674825 7:102061338-102061360 CACTGGGGCTGGGGGCCACATGG - Intronic
1030144671 7:106341218-106341240 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1030222505 7:107111144-107111166 CTATAGTGGTGGTGGCCACAGGG + Intronic
1031546128 7:123053271-123053293 CTGGGGTGGTGGTGACCACAGGG - Intergenic
1031883701 7:127223706-127223728 CCGTGGGAGTGGAGGTCACATGG + Intronic
1031905876 7:127458953-127458975 CTGGGGTGGTGGCGGCCACAGGG + Intergenic
1032318288 7:130861268-130861290 CTGTAGCGGTGGGGTCCTCATGG + Intergenic
1032845158 7:135745770-135745792 TGGTGGGGCTGGGGGCCAAAGGG + Intronic
1032958956 7:137007461-137007483 TGGTGGGGGTGGTGGCCGCAAGG - Intronic
1033419705 7:141194777-141194799 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1033867746 7:145713388-145713410 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1033871771 7:145762744-145762766 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
1034739692 7:153462557-153462579 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1034746314 7:153526931-153526953 CTGTGGAGGTGGGATCCACAAGG + Intergenic
1034750034 7:153559971-153559993 CTGCTGGGGTGGGGCCCTCATGG - Intergenic
1034851924 7:154501691-154501713 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035391690 7:158508592-158508614 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391703 7:158508649-158508671 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391715 7:158508706-158508728 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391727 7:158508763-158508785 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391739 7:158508820-158508842 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391752 7:158508877-158508899 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035538868 8:416174-416196 CAGTGGGGCTGTGGGCCGCATGG - Intronic
1035559915 8:596500-596522 CTGAGGCAGTGGGGGCCTCAGGG + Intergenic
1035605400 8:926946-926968 CTGTGGGGGTGGGGACAGCGTGG + Intergenic
1035732628 8:1863591-1863613 CTGCGTGGGTGCGGGCCACGTGG - Intronic
1035860812 8:3026191-3026213 CTGGTGGGGTGGGGGACAGAGGG + Intronic
1036728718 8:11243169-11243191 TGGTGGGAGTGGGGGACACATGG + Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037876822 8:22552514-22552536 CTGTGGTGGGGGGCGACACAAGG + Intronic
1037974833 8:23201679-23201701 CTATGGGGGTGGAGGCACCATGG + Intronic
1038139044 8:24822649-24822671 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1038865777 8:31437248-31437270 GTGGGGGGGTGGGGGGCAAAAGG + Intergenic
1040303196 8:46198723-46198745 GTGTGGGTTTGAGGGCCACAGGG + Intergenic
1040628203 8:49175992-49176014 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1040813424 8:51481891-51481913 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1040850858 8:51899181-51899203 CTGAGGGGGGCGGGGCCAGATGG - Intronic
1041579855 8:59446638-59446660 CAGTTGTGGTGGTGGCCACAGGG - Intergenic
1041606971 8:59793089-59793111 CTGGGGCAGTGGTGGCCACATGG + Intergenic
1041984820 8:63909335-63909357 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1042602549 8:70512691-70512713 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1042631498 8:70821539-70821561 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
1042646068 8:70987801-70987823 CTGTAGGGGTGGGGTCCTCATGG - Intergenic
1043040170 8:75253117-75253139 CTGCAGTGGTGGGGCCCACATGG - Intergenic
1043165948 8:76902684-76902706 CAGTTGGGGTGGGGGCCAAGAGG - Intergenic
1043510528 8:80946162-80946184 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1043623784 8:82229858-82229880 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1043851868 8:85225114-85225136 CTGTGGTAGGGGGTGCCACAGGG - Intronic
1044428737 8:92084093-92084115 CTGTCGGGGTGGGGGGCTAAGGG + Intronic
1044513231 8:93108349-93108371 CTGTGAGGATATGGGCCACATGG - Intergenic
1045061314 8:98413788-98413810 CTCCGAGGGTGGGGGCCTCAGGG + Intronic
1045214155 8:100130127-100130149 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1045544450 8:103115835-103115857 CTGTAGGGAAGGGGGCTACAGGG - Intergenic
1045561833 8:103271534-103271556 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1045940057 8:107728443-107728465 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
1046129286 8:109946805-109946827 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1046341908 8:112869876-112869898 CTGTTGGGGTGGGGGACAAGGGG + Intronic
1046368672 8:113271631-113271653 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1046606039 8:116373372-116373394 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1047490407 8:125369785-125369807 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1047628073 8:126677330-126677352 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1047630307 8:126699630-126699652 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1048660912 8:136600078-136600100 CTGCAGTGGTGGGGCCCACATGG + Intergenic
1048769734 8:137882772-137882794 CTGTAGGGTTGGGGTCCTCATGG + Intergenic
1048772762 8:137912899-137912921 CTGCAGGGGTGGGGTCCTCATGG - Intergenic
1048979642 8:139696527-139696549 CTGTGCTGGTGGGAGGCACACGG - Intronic
1049023054 8:139970858-139970880 CTGAAGGGATGGGGGCCACGTGG + Intronic
1049213350 8:141396676-141396698 AGGTGGGGATGGGGGCTACAGGG + Intronic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049753067 8:144294787-144294809 CTGTGTGGGTGGGGTGCTCATGG - Intronic
1049756724 8:144314102-144314124 CTGCGGGGGTGGGGGTGTCAAGG - Intronic
1050288656 9:4130703-4130725 CTGCAGGGGTAGAGGCCACACGG + Intronic
1050807107 9:9694736-9694758 CAGTGGTGGTGGCAGCCACAGGG - Intronic
1051767432 9:20540352-20540374 CTGGAAGGGTGGAGGCCACATGG - Intronic
1052105558 9:24510397-24510419 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1052204868 9:25827458-25827480 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
1052210170 9:25894130-25894152 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1052428632 9:28337861-28337883 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1052732942 9:32310905-32310927 CCGTGGTGGTGGTGGCCACAGGG + Intergenic
1052998570 9:34564833-34564855 CTGTGGGGGGTGGGGGCACAGGG + Intronic
1053052877 9:34976438-34976460 CTGTGGGTTTGGGGGCCCCGAGG + Intronic
1053384158 9:37673618-37673640 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1053522379 9:38793149-38793171 CGGTGGGGGTGGGGGCCTAGGGG - Intergenic
1053561877 9:39204688-39204710 CTTTGGGGGTGGGGGGCTCCTGG + Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053746160 9:41199723-41199745 CTGTAGGGGTGGGTCCCTCATGG - Intergenic
1053893435 9:42719035-42719057 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1054135241 9:61414264-61414286 CTTTGGGGGTGGGGGGCTCCTGG - Intergenic
1054481110 9:65665494-65665516 CTGTAGGGGTGGGTCCCTCATGG + Intergenic
1054602873 9:67144735-67144757 CTTTGGGGGTGGGGGGCTCCTGG - Intergenic
1054682186 9:68231557-68231579 CTGTAGGGGTGGGTCCCTCATGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054873213 9:70068348-70068370 CTGTGGGGGTAGGGAGCACTGGG + Intronic
1055024338 9:71703318-71703340 CTGTGTGGGTGGGGCACAGAGGG + Intronic
1055794081 9:79955395-79955417 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1055975978 9:81955610-81955632 CTGCAGGGGTGGGGACCTCATGG - Intergenic
1056112581 9:83410295-83410317 CTGTGGGGGAGGGAGGGACAAGG - Intronic
1056516806 9:87359809-87359831 CTGGGGTAGTGGTGGCCACAGGG + Intergenic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1056639407 9:88357764-88357786 CTATGGGGGTGGGGCCCTCATGG + Intergenic
1056659888 9:88535750-88535772 CTGGGGGGGCGGGGGCCGCCCGG + Intronic
1056702016 9:88918744-88918766 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1056902338 9:90611684-90611706 CTGGGGGGGTGGGGGCTGCATGG - Exonic
1057112810 9:92490122-92490144 CTGTGGAGGTGCTGGGCACAGGG - Intronic
1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG + Intergenic
1057542400 9:95987822-95987844 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1057645108 9:96866502-96866524 CTGCTGGGGTGGGGCCCTCATGG + Intronic
1058004561 9:99901753-99901775 CTGCAGGGGTGGGGTCCTCATGG - Intergenic
1058065630 9:100545225-100545247 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1058082222 9:100712429-100712451 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1058193059 9:101941537-101941559 CTGAGGGGGTGGAGCCAACATGG - Intergenic
1058330741 9:103756926-103756948 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1058380461 9:104371884-104371906 CTGTAGGGGTGGGGTCCTCATGG + Intergenic
1058649218 9:107159427-107159449 CTGCAGGGGTGGGGGCCTCATGG + Intergenic
1058940528 9:109809046-109809068 CTGCAGGGGTGGGGCCCTCATGG + Intronic
1059396079 9:114034967-114034989 CTGTGGGTGCTGGGGCCACCAGG - Intronic
1059429536 9:114241506-114241528 CTGTGGGGGTGGGGAGCACCTGG + Intronic
1059450922 9:114371017-114371039 CTGGGGGGGAGGTGGCAACATGG + Intronic
1059454290 9:114389930-114389952 ATGTGGGGCTGGGGGCTACAGGG - Intronic
1059582585 9:115567604-115567626 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1059587237 9:115619612-115619634 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1060508669 9:124216691-124216713 CTGTGGGGAAGGGGTGCACAGGG + Intergenic
1060722551 9:125988662-125988684 CAGTGGGGGAGGGAGCCACATGG - Intergenic
1060754718 9:126204285-126204307 CTGTGGGGGTAGGGACCAAGGGG - Intergenic
1061256869 9:129458723-129458745 CTGTGGGGGTAGGGGGCGAAAGG - Intergenic
1061404967 9:130388665-130388687 TGGTGGGGGGGGGGGCAACACGG - Intronic
1061664860 9:132154719-132154741 CTTTTGGGGTGGGGCCTACATGG + Intergenic
1061755155 9:132807187-132807209 CTGGGGGGGGCGGGGCCACAGGG + Intronic
1061912945 9:133734603-133734625 AAGTGGGGGTCGGGGCCACAAGG + Intronic
1062265061 9:135683256-135683278 CTGGGGAGATGGGGGCCACCCGG - Intergenic
1062360291 9:136185065-136185087 GCCTGGGGGTCGGGGCCACATGG - Intergenic
1062393064 9:136341646-136341668 CTTTGGGAGTGGGGGACACATGG - Intronic
1062446943 9:136599068-136599090 ATGTTGGGGTGGGGCTCACAAGG + Intergenic
1062517436 9:136943672-136943694 CTTGGGGGGTGGGGGGTACAGGG - Intronic
1062533151 9:137010494-137010516 CTCTGGGGGTGGGGCCTGCATGG - Intronic
1062592842 9:137281720-137281742 GGGTGGGGGTGGGGGCTACCAGG + Exonic
1062594990 9:137295517-137295539 CAGTGCGGGCGGCGGCCACAGGG + Intergenic
1062619255 9:137412039-137412061 CTGTGGGGGTGGGGGAGCCTGGG - Intronic
1202782289 9_KI270718v1_random:10496-10518 CTGTAGGGGTGGGTCCCTCATGG - Intergenic
1185492838 X:532023-532045 CAGTGGGGTGGGGGGCCAGAGGG - Intergenic
1186053331 X:5623750-5623772 CTGCGGGAGTGGGGTCCTCATGG + Intergenic
1186706998 X:12151333-12151355 GTGAGGGGGTGGGGTGCACAAGG + Intronic
1187314866 X:18183743-18183765 CTGCGGCAGTGGTGGCCACAAGG + Intronic
1187555202 X:20344716-20344738 CTGTAGGGGTGGAGCCCTCATGG + Intergenic
1187636867 X:21238667-21238689 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1187638681 X:21262666-21262688 CTGTCGGGGGGTGGGGCACAAGG - Intergenic
1187889388 X:23920066-23920088 CAGTGGTGGTGGTGGCCACAAGG - Intronic
1188187292 X:27130752-27130774 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188413577 X:29904519-29904541 CTGTCGGGGTTGGGGGCAAAGGG - Intronic
1188748212 X:33873256-33873278 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1188776813 X:34230180-34230202 CGGCAGGGGTGGGGGTCACAAGG + Intergenic
1188804484 X:34570382-34570404 CTGTAGGGGTGAGGTCCTCATGG - Intergenic
1188854200 X:35171955-35171977 CAGTGGTGGTGGTAGCCACAGGG - Intergenic
1188917812 X:35934324-35934346 CAGTGGTGGTGGCGGCCATAGGG - Intronic
1188932015 X:36123554-36123576 CTGTGGTGGTTGTGGCCACAGGG - Intronic
1188972262 X:36632570-36632592 CTGTGGTGATGGTGGACACAAGG - Intergenic
1188996145 X:36888080-36888102 CTGTGGTGGTGGTAGCCACAGGG + Intergenic
1189484681 X:41421022-41421044 CTTTTGGGGTTCGGGCCACATGG + Intergenic
1189916632 X:45862231-45862253 CTGTCGGGGGTGGGGGCACAGGG + Intergenic
1190016791 X:46834744-46834766 CTGTGGGGGTGGGAGGCATGTGG - Intergenic
1190287786 X:48972091-48972113 GAGTGGGGGTGGGGGCCCCTGGG - Intergenic
1190588100 X:51967552-51967574 CAGTGTTGGTGGTGGCCACAGGG - Intergenic
1191104630 X:56764809-56764831 GGGTAGGGGTGGGGGCCACAGGG + Intergenic
1191593176 X:62911949-62911971 CTGGGGTGGTGGTGGCCACAGGG - Intergenic
1191703796 X:64071242-64071264 CTGTGGTGGTGGTGGCAACAGGG + Intergenic
1192008909 X:67247272-67247294 CTGGGGTGGGGGGGGTCACAGGG + Intergenic
1192473671 X:71420749-71420771 CCGTGGGGGTGGGGGGCGCAAGG + Intronic
1192676257 X:73199706-73199728 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1192841945 X:74865913-74865935 CTGCCGGGGTGGGGCCCTCATGG + Intronic
1192887161 X:75347738-75347760 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1193112332 X:77742684-77742706 CTGTGTGGCTGGGACCCACAGGG + Intronic
1193194805 X:78619455-78619477 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1193318965 X:80097897-80097919 TTGTGGGGGCGGGGGCTGCAAGG - Intergenic
1193320415 X:80114977-80114999 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1193797238 X:85891649-85891671 CTGCAGGGGTGGGGCCCCCATGG + Intronic
1194066453 X:89267535-89267557 CGGTGGGGGTGGGGGTTGCATGG + Intergenic
1194145299 X:90254790-90254812 CTCTAGGGGTGGGGCCCTCATGG - Intergenic
1194692875 X:97009191-97009213 CTGGGGTGGTGATGGCCACACGG - Intronic
1194841925 X:98753776-98753798 TGGTGGTGGTGGTGGCCACAGGG - Intergenic
1195199409 X:102533164-102533186 CAGTGGTGGCGGTGGCCACAGGG + Intergenic
1195210073 X:102646072-102646094 CTGCAGGGGTGGGGCCCTCATGG - Intergenic
1195289997 X:103423457-103423479 CTGCAGTGGTGGTGGCCACAGGG - Intergenic
1195290628 X:103429241-103429263 GGGTGGGGGCGGGGGTCACAAGG + Intergenic
1195291591 X:103435226-103435248 GGGTGGGGGCGGGGGTCACAAGG + Intergenic
1195852109 X:109294861-109294883 CTTTGGTGGTGGTGGCTACAGGG - Intergenic
1195872518 X:109500991-109501013 CTGTGGGGGTGGGGACACTAAGG - Intergenic
1195971463 X:110478049-110478071 CAGTGGTGGCGGTGGCCACAGGG - Intergenic
1196036364 X:111149464-111149486 CTGCAGGGGTGGGGCCCTCATGG - Intronic
1196278573 X:113796841-113796863 CTGCAGGGGTGGGGTCCTCATGG + Intergenic
1196285214 X:113871687-113871709 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1196387862 X:115177790-115177812 CTGTGGGGGTGTGGGGGGCAAGG - Intronic
1196495405 X:116318421-116318443 CTGTGGGAGTGGTGGCCATGGGG + Intergenic
1196510080 X:116499230-116499252 CAGTGGTGGTGGTAGCCACAGGG - Intergenic
1196517848 X:116634053-116634075 CTGTCGGGGTGGGGGGCAAGGGG + Intergenic
1196909155 X:120468606-120468628 GTGTGTGGGTGGGGGACAGATGG - Intronic
1197068583 X:122266284-122266306 TTGTAGTGGTGGTGGCCACAGGG - Intergenic
1197099516 X:122636372-122636394 CTGGGATGGTGGTGGCCACAGGG - Intergenic
1197142181 X:123129843-123129865 CTGTGGGGGTGGGATCCTCTGGG - Intergenic
1197376043 X:125682777-125682799 CAGTGGTGGTGGTGGGCACAGGG + Intergenic
1197488816 X:127090258-127090280 CTGGGGTGGTTGGGGCCACGGGG - Intergenic
1197579385 X:128262937-128262959 CAGCAGGGGTGGGGGTCACAAGG + Intergenic
1197600419 X:128520642-128520664 CTGTGGTGGCAGTGGCCACAAGG + Intergenic
1197774845 X:130111923-130111945 TTTTGGGGGTGGGGGCAGCAAGG + Intergenic
1197864958 X:131007990-131008012 CTGTGGGGTTGGCTGGCACAGGG - Intergenic
1198293074 X:135257396-135257418 CAGTGGTGATGGTGGCCACAGGG + Intronic
1198569788 X:137942475-137942497 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198748351 X:139913637-139913659 CGGTAGGGGCGGGGGACACAAGG - Intronic
1198841076 X:140858837-140858859 CTGTGGTGGTGGTGGCCATTGGG + Intergenic
1198995175 X:142566499-142566521 ATGTGGTGGTGGTAGCCACAGGG - Intergenic
1199036131 X:143053033-143053055 CTGTGGTAGTGGTGGCTACAGGG - Intergenic
1199217883 X:145282078-145282100 CTGTGGTGGCAGTGGCCACAAGG - Intergenic
1199291097 X:146105800-146105822 TTGTAGGGGTGGGGCCTACATGG - Intergenic
1199663540 X:150078539-150078561 TTGTAGGGGTGGGGTCCAAAGGG - Intergenic
1200101860 X:153692322-153692344 CAGTGGGGGTGATGGGCACAGGG - Intronic
1200491061 Y:3824088-3824110 CTCTAGGGGTGGGGCCCTCATGG - Intergenic
1200714324 Y:6520468-6520490 CTGTGGGTGGGCGGGCCTCAGGG - Intergenic
1200720623 Y:6601656-6601678 CGGTGGGGGTGGGGGTTGCATGG + Intergenic
1201452265 Y:14129267-14129289 CTGCAGGGGTGGGGCCCTCATGG + Intergenic
1201640809 Y:16174632-16174654 CAGTAGGGGAGGGGGTCACATGG + Intergenic
1201662007 Y:16410694-16410716 CAGTAGGGGAGGGGGTCACATGG - Intergenic
1202075905 Y:21037853-21037875 GAGTGGGGGGGGGGGTCACAAGG - Intergenic