ID: 1064138995

View in Genome Browser
Species Human (GRCh38)
Location 10:12774428-12774450
Sequence AGGGAGCAGGGGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064138988_1064138995 7 Left 1064138988 10:12774398-12774420 CCTGAAGGCAGGAGAATGTGGGC 0: 1
1: 0
2: 0
3: 30
4: 275
Right 1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG No data
1064138981_1064138995 25 Left 1064138981 10:12774380-12774402 CCAGGCCCAGTGCAGAGGCCTGA 0: 1
1: 0
2: 5
3: 67
4: 642
Right 1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG No data
1064138984_1064138995 19 Left 1064138984 10:12774386-12774408 CCAGTGCAGAGGCCTGAAGGCAG 0: 1
1: 1
2: 14
3: 70
4: 494
Right 1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG No data
1064138983_1064138995 20 Left 1064138983 10:12774385-12774407 CCCAGTGCAGAGGCCTGAAGGCA 0: 1
1: 0
2: 2
3: 33
4: 268
Right 1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064138995 Original CRISPR AGGGAGCAGGGGAAGCAGGA AGG Intronic
No off target data available for this crispr