ID: 1064140059

View in Genome Browser
Species Human (GRCh38)
Location 10:12782926-12782948
Sequence CTGTTATCTCAGATCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064140059 Original CRISPR CTGTTATCTCAGATCCAGCA TGG (reversed) Intronic
900565182 1:3328663-3328685 CTGTTTTATCAGACCCAGGAAGG + Intronic
904303183 1:29569298-29569320 CTGTTTTCTCAGCTTCATCAGGG + Intergenic
904847607 1:33431584-33431606 CAGTTTTTTCAAATCCAGCAGGG + Intergenic
905310024 1:37042726-37042748 GTGTTATCTCCGAGGCAGCAGGG + Intergenic
907712232 1:56894464-56894486 CTGTTATCTGGTATCCATCAGGG - Intronic
911299039 1:96150882-96150904 CTGTCATCTCTGAACCACCAAGG - Intergenic
911883243 1:103267972-103267994 CTGTTATCTCAGGTAGTGCAGGG - Intergenic
916212554 1:162370675-162370697 CTGATACCTCTGATCCCGCAGGG - Intronic
920217594 1:204372283-204372305 CTGATACCTCACACCCAGCAAGG + Intronic
920962397 1:210674995-210675017 CTGTGATCTGAGCTTCAGCAGGG + Exonic
924600645 1:245485774-245485796 CTGTGATCCCAGAGCCTGCAGGG + Intronic
1064140059 10:12782926-12782948 CTGTTATCTCAGATCCAGCATGG - Intronic
1066094672 10:32060634-32060656 ATGTTATCACAGAACCAGGAAGG + Intergenic
1066614501 10:37281679-37281701 CTGTTCTCTCTGAACCACCAAGG + Intronic
1068240727 10:54298439-54298461 CTGTCCTCTCTGAACCAGCAAGG - Intronic
1068629394 10:59284391-59284413 CTGTCCTCCCAGCTCCAGCAGGG + Intronic
1070418778 10:76215322-76215344 TTGCCATCTCAGATACAGCAAGG - Intronic
1071251012 10:83819747-83819769 CTTTTCTCTCAGACTCAGCAAGG - Intergenic
1073313829 10:102564070-102564092 CTGTCTTCTCAGATCCAAGAGGG + Intronic
1073716651 10:106115170-106115192 CAGATTCCTCAGATCCAGCAGGG - Intergenic
1077855103 11:6116169-6116191 CAGATTTCTCAGAGCCAGCAGGG - Intergenic
1080703730 11:34668453-34668475 CTGTTTTCACAGCTTCAGCAGGG - Intergenic
1083198790 11:61106991-61107013 CTATTATGCCAGATCCACCAGGG - Intronic
1085710217 11:78822920-78822942 CTGTTATCTCAGGAACCGCAGGG - Intronic
1085723437 11:78933148-78933170 CTTTTACCTCAGATGCAGCCAGG - Intronic
1087030278 11:93696789-93696811 CTGTTATATCAGTGCCATCATGG + Exonic
1089708715 11:120299696-120299718 CTGCTATCTCAGACCCAGCCTGG + Exonic
1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG + Intergenic
1090247157 11:125224665-125224687 CTGTGATCCCAGATCCAGGTGGG + Intronic
1091689962 12:2589208-2589230 CTGATATGTCAGTTCCAGGAGGG - Intronic
1094341229 12:29413389-29413411 CTGTCATTTCAGATTCAACAAGG - Intronic
1094454665 12:30619233-30619255 ATGCTATCTCAGGCCCAGCATGG + Intergenic
1095593810 12:43936708-43936730 CTGTTAGGTCAGATGCAGCCAGG + Intronic
1095843725 12:46722927-46722949 CTGTTTTCTCAGACCTGGCAGGG + Intergenic
1097633712 12:62096199-62096221 CAGGAATCCCAGATCCAGCAGGG - Intronic
1108947060 13:56040234-56040256 CTGACATTTCTGATCCAGCAAGG - Intergenic
1109060993 13:57620197-57620219 CTCTTGTCTGAGAACCAGCAAGG + Intergenic
1109424510 13:62152850-62152872 CTGTTGTCTCTGAACCACCAAGG - Intergenic
1110375376 13:74787387-74787409 GTGGTATCTCAGACCTAGCAGGG + Intergenic
1113203842 13:107894354-107894376 CTGTCCTCTCTGAACCAGCAAGG + Intergenic
1116168667 14:41369478-41369500 CTGTAATTTCAGAGCAAGCATGG + Intergenic
1117238609 14:53804789-53804811 CTGCTATCACAGATAAAGCAAGG - Intergenic
1117550423 14:56830677-56830699 CAGTTATCTGAGATCAACCAGGG - Intergenic
1122089233 14:99327258-99327280 CCATTCTCTCACATCCAGCAAGG - Intergenic
1127495989 15:59512696-59512718 CTGTTATGTGAGAGCCAGCATGG - Intronic
1129292324 15:74577826-74577848 CTGTAATCTGAGGCCCAGCACGG - Intronic
1133779041 16:8922494-8922516 CTGTTCTGTCAGATCCCCCAGGG - Intronic
1138123843 16:54422720-54422742 ATGTTATCTCAGCTCCATCTTGG - Intergenic
1138242895 16:55443068-55443090 CTGCTATTTAAGATCCAGCCCGG + Intronic
1138598640 16:58042423-58042445 CTCTTCTCTCAGATCCAGCAGGG - Intronic
1140977196 16:80071548-80071570 GTGTAATCTTAGATCCAGCCAGG - Intergenic
1142018927 16:87767939-87767961 ATGTTATCTTAGATCCAGCCAGG + Intergenic
1143269177 17:5663094-5663116 CTGATATCTAAGAGCCAGAAAGG - Intergenic
1145257968 17:21337894-21337916 CTCTTAGCTCACAGCCAGCAAGG - Intergenic
1145318670 17:21750112-21750134 CTCTTAGCTCACAGCCAGCAAGG + Intergenic
1145849958 17:28083412-28083434 CTGTTATATCACATTCAGAAAGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1149684053 17:58525341-58525363 CTGTTCTCTGGGAACCAGCAAGG + Intronic
1150047146 17:61925043-61925065 CTGGTATCACAGCTTCAGCATGG - Exonic
1152827241 17:82474840-82474862 CTGTGATCTCAGCTCCAGATGGG + Intronic
1159568398 18:70083121-70083143 CTGGGTTCTCATATCCAGCAGGG + Intronic
1161418741 19:4163568-4163590 CAGTGATCTGAGATCCAGCCTGG - Intronic
1161920169 19:7260200-7260222 CTGTAATCTCAGACCCAGGGAGG + Intronic
1167255893 19:48428483-48428505 CTGTAATCTCAGCTACAGGAGGG - Intronic
1168181268 19:54664318-54664340 CTCTGATCTCAGATGCAGTAGGG - Exonic
1168185738 19:54698330-54698352 CTTTGATCTCAGACACAGCAGGG - Intronic
1168267346 19:55230053-55230075 CTTTTAGCTCAGGTCCACCATGG - Exonic
925751255 2:7091810-7091832 GTGTTATCACAGAACCAGAAAGG - Intergenic
929239430 2:39638924-39638946 ATGTTACCTCAAAACCAGCAGGG + Intergenic
929330451 2:40675105-40675127 CTGTCCTCTCTGAACCAGCAAGG - Intergenic
931540563 2:63325191-63325213 CTGTTCTCTCTGAACCACCAAGG - Intronic
934155595 2:89196885-89196907 CTTTTATCTCAGACCCACAAGGG + Intergenic
934211729 2:89985874-89985896 CTTTTATCTCAGACCCACAAGGG - Intergenic
938763857 2:134447595-134447617 CTCTGATATCAGATACAGCATGG + Intronic
944329036 2:198443268-198443290 CTGTTAGGTCAGCTCCATCAGGG - Intronic
944399688 2:199311216-199311238 CTATTAGCTCAGCTCCATCAGGG - Intronic
947359790 2:229335287-229335309 CTGTTCTCTCAGATTCTGCAGGG - Intergenic
1172748241 20:37230207-37230229 CTGTTTTCTCAGTTCAAGGATGG - Intronic
1173473877 20:43344830-43344852 CTGTTGTCCCAGATCCACCATGG + Intergenic
1175077131 20:56385293-56385315 CACTTATCTCAGAGCCTGCAGGG + Intronic
1176657185 21:9597593-9597615 CTATTAACTCAAACCCAGCAAGG - Intergenic
1178948104 21:36965051-36965073 CTGTTTTCTCAGGTCCCCCAAGG - Intronic
950769659 3:15301413-15301435 CTGGCATTGCAGATCCAGCAAGG + Intronic
951578346 3:24136341-24136363 CTGGTATCTAAGATCCATTATGG - Intronic
953515156 3:43583647-43583669 ATGCTACCTCCGATCCAGCAGGG + Intronic
954264731 3:49463285-49463307 ATCTTATCCCAGAGCCAGCAGGG - Intergenic
954631199 3:52048467-52048489 CTGATATCTCAGGACCTGCAGGG + Intergenic
955061940 3:55500126-55500148 CTGTTTTCTCATTTCCAGAAGGG - Intergenic
960635091 3:119777096-119777118 CTGTCATCTATGATCCAGGAAGG - Intergenic
962352242 3:134664525-134664547 CTGGGATCTCAGATACATCAGGG + Intronic
962382842 3:134911256-134911278 CTATTCTCTCAGAGCCTGCAGGG + Intronic
964184197 3:153923209-153923231 CTGTTATATCAGAGGCAGCATGG + Intergenic
964280629 3:155060730-155060752 CTGTAATCACAGTGCCAGCATGG + Intronic
967678881 3:192335716-192335738 CTGAAATCTCAGATCCAGCTGGG - Intronic
969511606 4:7621038-7621060 CTGTGGTCTCAGAGCCAGCTGGG - Intronic
971123719 4:23729232-23729254 ATGTTAGCTCATATTCAGCATGG + Intergenic
971384211 4:26128061-26128083 CTGTTATCTGAAAGGCAGCAGGG - Intergenic
977382834 4:96298646-96298668 CCTATATCTCAGAACCAGCAAGG - Intergenic
981537881 4:145819194-145819216 GTGTTATTTCAGATGCAGCCTGG - Intronic
985003872 4:185513244-185513266 TTGTGATATCAGATCCAGAAAGG - Intronic
985418241 4:189758536-189758558 CTATTAACTCAAACCCAGCAAGG + Intergenic
985758376 5:1732573-1732595 CTGCTCTCTCAGAGCCTGCAGGG + Intergenic
986415246 5:7521685-7521707 CTGGTTTCTCAGACCCAGCAGGG - Intronic
988957957 5:36337693-36337715 CTCTGATCTCAGACCCAGAATGG - Intergenic
993171396 5:84423912-84423934 CTGTAATCTCTGATGCTGCAAGG - Intergenic
997233223 5:132258276-132258298 CTGTCTTCTCAGATTCAGCGAGG - Intronic
998519828 5:142790182-142790204 GTGTTATCTCATTTCCATCATGG - Intronic
1001144259 5:169170096-169170118 TTGTTACCTCCCATCCAGCAAGG - Intronic
1003805839 6:9725261-9725283 CTGTTCTCTCTGAACCACCAAGG - Intronic
1005796391 6:29366380-29366402 CAGATATCTCAAATTCAGCATGG - Intronic
1007030093 6:38619378-38619400 CTGTTTTCTCTGAACCACCAAGG - Intronic
1007849019 6:44785705-44785727 CTATGATCTCAGAGCCAGGAAGG - Intergenic
1008457044 6:51723216-51723238 CTGTGATGTCAGCTCCAACATGG + Intronic
1009036229 6:58120101-58120123 CAGATTTCTCAGATCCCGCAAGG + Intergenic
1009212045 6:60873720-60873742 CAGATTTCTCAGATCCCGCAAGG + Intergenic
1010382871 6:75244465-75244487 TTGCTGTCCCAGATCCAGCAGGG + Intronic
1013969078 6:115994444-115994466 CTGTTAACTCACACACAGCAGGG + Intronic
1014330238 6:120055407-120055429 CTGTCATCTCAGTTCAGGCACGG - Intergenic
1014702183 6:124703707-124703729 CAGATATGTCAGAGCCAGCACGG - Intronic
1016321786 6:142854354-142854376 CGGTTTTCTTAGCTCCAGCATGG - Intronic
1016773323 6:147876224-147876246 CTTCTCTCTCAGAACCAGCAGGG - Intergenic
1016861047 6:148719174-148719196 TTGTTCTCTCAGAGCCAGGACGG - Intergenic
1017519445 6:155188584-155188606 GTGTTATTTCAGAGCCAACAAGG + Intronic
1019684965 7:2376662-2376684 CAGTTAGCTTACATCCAGCATGG + Intronic
1021356538 7:19658078-19658100 CTGTTCTCTCTGAACCACCAAGG + Intergenic
1022382812 7:29875884-29875906 CTGTTGGCTGATATCCAGCAAGG + Exonic
1023283672 7:38596330-38596352 CTCTTGTCTCAGTTCCAGCCTGG + Intronic
1024701903 7:51912654-51912676 CAGGTATCTCAAATTCAGCATGG + Intergenic
1026208447 7:68280019-68280041 CTGTTTTCTCAGGGCCTGCAAGG - Intergenic
1026393696 7:69928858-69928880 CTGTTCACTTAGAACCAGCAAGG - Intronic
1029598725 7:101551253-101551275 CTGTTGCCTGAGCTCCAGCAGGG - Intronic
1031092901 7:117383186-117383208 CGATTATCTCATATCCAGAAAGG + Intronic
1033433617 7:141312210-141312232 ATCTTATCTCAGATTCAACATGG + Intronic
1034140110 7:148807696-148807718 CTGTTGTTTCAGATACAGCCAGG - Exonic
1035994867 8:4534476-4534498 CTTTTATTTCAGATACAGCGGGG + Intronic
1036142046 8:6217659-6217681 CTGTTTTCTCAGGTACTGCAGGG - Intergenic
1036680779 8:10871722-10871744 CTGATATGTCAGAGCCAGTATGG - Intergenic
1043588682 8:81799818-81799840 CTGTTATATAAGATACAGAATGG + Exonic
1044496187 8:92886657-92886679 CTTTTATCTCAGACTCACCACGG - Exonic
1044508545 8:93049115-93049137 TGGTTACCTCAGAGCCAGCAGGG + Intergenic
1047844256 8:128788909-128788931 CTGTTATCACAAATACATCATGG - Intergenic
1048573722 8:135675220-135675242 CTGTTATCTTGGATGGAGCAAGG + Intergenic
1049954668 9:681314-681336 CTGTTCTCTCATAGCCAGCTAGG + Intronic
1050076918 9:1875155-1875177 CTGCTGTCTCAGGTGCAGCAAGG + Intergenic
1052321662 9:27173954-27173976 CTTTTATGTCAGATCCAGACAGG + Intronic
1055555435 9:77468767-77468789 TTGTTATCCCAGGTCCTGCACGG + Intronic
1056050037 9:82758656-82758678 CTTCCATCTCAGAGCCAGCAAGG + Intergenic
1058530320 9:105899995-105900017 CTGATTCCTCAGAGCCAGCAGGG + Intergenic
1059910112 9:119033778-119033800 CTGTTATCCAAGAACCAGGAAGG + Intergenic
1060353646 9:122882750-122882772 ATGTTATCTCAGATACAACCAGG - Intronic
1061702377 9:132425428-132425450 CTGTAATCTCATTTTCAGCATGG - Intronic
1062498698 9:136843279-136843301 CTGTGATCCCAGAGCCAGCTGGG - Intronic
1203634907 Un_KI270750v1:101167-101189 CTATTAACTCAAACCCAGCAAGG - Intergenic
1188410920 X:29871158-29871180 CTGTGATCAGAGATACAGCATGG - Intronic
1191768802 X:64732900-64732922 CAGATTTCTCAGAGCCAGCAGGG + Intergenic
1194762737 X:97813804-97813826 CTGTTATCTCAGAATGGGCACGG + Intergenic
1198368969 X:135973306-135973328 AAGTGATGTCAGATCCAGCATGG - Intronic
1199096913 X:143754231-143754253 GTGAGATCTCAGCTCCAGCAAGG + Intergenic
1199420003 X:147634300-147634322 CTGTCATCTCAGCTCAAACAGGG + Intergenic
1202242922 Y:22789114-22789136 CTGTCCTCTCTGAACCAGCAAGG - Intergenic
1202395909 Y:24422864-24422886 CTGTCCTCTCTGAACCAGCAAGG - Intergenic
1202474876 Y:25247228-25247250 CTGTCCTCTCTGAACCAGCAAGG + Intergenic