ID: 1064140729

View in Genome Browser
Species Human (GRCh38)
Location 10:12788086-12788108
Sequence CAGGATGACAATATTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064140729 Original CRISPR CAGGATGACAATATTGGGGA TGG (reversed) Intronic
909489679 1:76211966-76211988 CAGTATGACTATGTTGGAGATGG - Intronic
909994527 1:82262584-82262606 CAGTATGGAAATCTTGGGGAGGG + Intergenic
910775841 1:90873659-90873681 CAGGATGGAAATAGTGGAGATGG + Intergenic
911086873 1:93985803-93985825 CAGGAGGACAATGGTGGAGATGG + Intergenic
911912442 1:103653314-103653336 CAGGATGACAATAAGGGGCAAGG - Intergenic
911916012 1:103698634-103698656 CAGGATGACAATAAGGGGCAAGG + Intronic
913564687 1:120061540-120061562 CATGATGATAATATTGTGGTTGG - Intronic
913633444 1:120732023-120732045 CATGATGATAATATTGTGGTTGG + Intergenic
914285276 1:146220890-146220912 CATGATGATAATATTGTGGTTGG - Intronic
914546307 1:148671645-148671667 CATGATGATAATATTGTGGTTGG - Intronic
914620258 1:149399025-149399047 CATGATGATAATATTGTGGTTGG + Intergenic
915524690 1:156468400-156468422 GAGGATGAGAATATGGGGGATGG + Intronic
918139150 1:181705668-181705690 AAGGATGACAGAATTGGGTAAGG + Intronic
918626899 1:186666218-186666240 CAAGATGTCAACATTGGGGGAGG - Intergenic
920410221 1:205753391-205753413 CATTCTGACAATAGTGGGGATGG - Intergenic
920653816 1:207859787-207859809 CAGGAAGAACATATTGGGGAGGG + Intergenic
920791298 1:209095517-209095539 TAGCATGAAAAGATTGGGGAAGG + Intergenic
921781244 1:219167406-219167428 CAGGATCACAATATTAGGCCTGG - Intergenic
1062824226 10:556624-556646 CAGGGTGGCAACATTGTGGAGGG - Intronic
1064140527 10:12786442-12786464 CAGGATGACAATATTGGCGATGG - Intronic
1064140729 10:12788086-12788108 CAGGATGACAATATTGGGGATGG - Intronic
1064168644 10:13008382-13008404 GAGGATGTCCATGTTGGGGAAGG + Intronic
1071563856 10:86661701-86661723 CAGGATGACACTGTCGGGGAGGG - Intronic
1072094143 10:92160525-92160547 CAGCATAACATCATTGGGGATGG - Intronic
1072376501 10:94821943-94821965 GAGGATCACTATATAGGGGAGGG - Intronic
1073621272 10:105051328-105051350 CAGGAAGTGAAAATTGGGGATGG + Intronic
1073828933 10:107359473-107359495 CAGGATGAGAATATTTGGTTGGG + Intergenic
1078629761 11:12991413-12991435 CAGGATTTCAATATTTGGGATGG - Intergenic
1078678671 11:13453477-13453499 CAAAATGATAATATTGAGGAAGG + Intronic
1078753543 11:14187502-14187524 CAGGATGGCAATATGAGGCAGGG - Intronic
1080812485 11:35718507-35718529 CAGGATGATAATAGTTGGGGAGG - Intronic
1081152294 11:39647707-39647729 CAGGATGCCAATATTGTTCAGGG - Intergenic
1084669954 11:70599993-70600015 CAGGAAGACAACATTGTGAAGGG + Intronic
1090306029 11:125692107-125692129 CAGGATGTTAATATTGGGGGAGG + Intergenic
1092027913 12:5258506-5258528 GAGGATGCCTACATTGGGGAGGG - Intergenic
1092377798 12:7970138-7970160 GAGAAAGACAAGATTGGGGATGG - Intergenic
1092404576 12:8210019-8210041 CAGGATTTCAAGGTTGGGGAAGG - Intergenic
1098164715 12:67682523-67682545 CAGGATGACAACCTTGAGGCAGG + Intergenic
1098870761 12:75814491-75814513 CAGGGTGAAAATACTGGGGTAGG + Intergenic
1099016980 12:77355103-77355125 GGGGATGGCAAAATTGGGGATGG + Intergenic
1100240729 12:92708240-92708262 CAGGAAGATAAAATTGGGCATGG - Exonic
1100992091 12:100262096-100262118 CAGGATGTTGATAATGGGGAAGG + Intronic
1102554698 12:113719245-113719267 CAAGAGGACACTGTTGGGGAAGG + Intergenic
1102775055 12:115511462-115511484 CAGGAAGACAGGATAGGGGAAGG - Intergenic
1103442059 12:120970518-120970540 CAGGCTGACAAAAGTGGGCAGGG + Intergenic
1107719165 13:43229847-43229869 TCAGATGAGAATATTGGGGAAGG + Intronic
1110733587 13:78909213-78909235 CAGGATGATGAAATTGGAGATGG + Intergenic
1112168594 13:96946811-96946833 CAGGATGACAGTGTGGGGAAGGG + Intergenic
1112835525 13:103509607-103509629 CAGGTCGACAACACTGGGGAAGG - Intergenic
1113368262 13:109698380-109698402 CAGGAGGAGAATATGGGGTAGGG + Intergenic
1115761771 14:36583088-36583110 CAGGATGACAAGTTTCAGGAGGG + Intergenic
1117927996 14:60805339-60805361 CAGGATGTTAATAATGGGGGAGG - Intronic
1117993273 14:61455535-61455557 CAGGATGCCAATATTGTGCGGGG + Intronic
1118443131 14:65829670-65829692 CAGGAGGACAGGAATGGGGAGGG + Intergenic
1118563872 14:67118052-67118074 CACCTTGACAATGTTGGGGAGGG + Intronic
1118963648 14:70559392-70559414 CAGGGTGATAATGATGGGGATGG - Intergenic
1119462453 14:74819250-74819272 CACAATGACAATATTGAGTATGG - Intronic
1121817645 14:96940789-96940811 CAGGTGGACAGTATTGGGTAGGG - Intergenic
1122273800 14:100580894-100580916 CAGGATGAGAATATAGGGGAGGG + Intronic
1122806919 14:104264529-104264551 CAAGATGCCAATACTGGGGCGGG - Intergenic
1125917094 15:43497443-43497465 CAGGATGAGAATTTTGAGGAGGG - Intronic
1126850296 15:52792461-52792483 CGGGATTAAAATATTGGGGCGGG - Intergenic
1130063992 15:80589943-80589965 CATGATGACAATAGTTGGTAAGG - Intronic
1131708100 15:95020595-95020617 TAGGATGAAAATCTTGGGCAAGG + Intergenic
1131880184 15:96854073-96854095 TAGGATGAGCATATAGGGGAGGG - Intergenic
1133842085 16:9419140-9419162 CAGAATGGCATGATTGGGGAAGG - Intergenic
1137989774 16:53142396-53142418 CAGAAAGAAAATATTCGGGATGG - Intronic
1138560168 16:57796508-57796530 CAGGGTGGCAATATGGGGGTTGG + Intronic
1139232915 16:65303696-65303718 CAGGATGTCAATAGTGGGGGAGG + Intergenic
1140216449 16:73012703-73012725 CAGGATCTCAAAATTTGGGATGG - Intronic
1141780791 16:86159318-86159340 CAGAATGAGAATGTTGAGGATGG + Intergenic
1143286279 17:5791576-5791598 CTGGATGAAAATTCTGGGGAGGG + Intronic
1144459722 17:15448679-15448701 GAGGATGGCAGTAGTGGGGAAGG - Intronic
1145846412 17:28042259-28042281 CAGGTTGACCTGATTGGGGAGGG - Exonic
1145901258 17:28491783-28491805 CAAGATGACCATGGTGGGGAAGG - Exonic
1146193080 17:30787644-30787666 CAGGATCATAATATTTGGGTAGG + Intronic
1146320939 17:31845932-31845954 CATGATGACATGACTGGGGAGGG - Intergenic
1146574651 17:33980506-33980528 AAGGATGAGAATCTTGGGAATGG + Intronic
1147282677 17:39375481-39375503 CAGGATGACTATAGTTGGCAAGG + Intronic
1148034474 17:44648484-44648506 CAGGATGCTGATATTGGGGGAGG + Intergenic
1150413959 17:64971701-64971723 CTGCATGGTAATATTGGGGATGG - Intergenic
1152219097 17:79051127-79051149 CAGCCTGAAAATATTGGGGGTGG - Intergenic
1153352717 18:4098660-4098682 AAGGAGGAAATTATTGGGGATGG + Intronic
1155339468 18:24799351-24799373 CAGGATGCAAATATAAGGGAGGG - Intergenic
1158968248 18:62642571-62642593 CAGGAGGAAAATAAGGGGGAAGG - Intergenic
1159890038 18:73944207-73944229 CAGCATGACAACGGTGGGGAGGG - Intergenic
1167317878 19:48776516-48776538 CAGGAAGACAAATTTAGGGAAGG + Intergenic
927720406 2:25378465-25378487 CAGGATGACACGACTTGGGAGGG + Intronic
929855773 2:45637679-45637701 CAGGATGACTGAATTGGGGCAGG + Intergenic
931965501 2:67529216-67529238 CAGGATGTCTATAATGGGGGAGG + Intergenic
932460054 2:71876221-71876243 AAGGATGTCAATCTTGGGGAGGG + Intergenic
935407920 2:102728533-102728555 AAGGATGACAGTATTTTGGAAGG - Intronic
935832320 2:107013040-107013062 CATGCTGACAATCTTGGTGAAGG + Intergenic
936771041 2:115913733-115913755 CAGGATGTCAGTAGTGGGGAAGG + Intergenic
938584356 2:132674568-132674590 CAGCATAACAATGTTGGGGGTGG - Intronic
938873906 2:135512112-135512134 CAAAATGACAATATTGGCTAGGG + Intronic
940815498 2:158293204-158293226 TAGGAAGACAATATGGGGGGTGG + Intronic
940992161 2:160108640-160108662 CTGAATCAGAATATTGGGGAAGG - Intronic
943370805 2:187013535-187013557 CAGGATGAGAATATTTGGGAAGG + Intergenic
944847149 2:203680565-203680587 CAGGAAGACCCTTTTGGGGATGG - Intergenic
948274454 2:236697361-236697383 CAGGATGACAGTAGTGGGAATGG + Intergenic
1170614593 20:17938498-17938520 CAGGATGCCAGCATTGGGGTTGG - Intergenic
1173085520 20:39912384-39912406 CATGAAGGCAATATTGGGGCTGG + Intergenic
1175539320 20:59738318-59738340 AAGGATGATAATAAGGGGGAGGG + Intronic
1176964698 21:15198846-15198868 CAAGTTGACAATTTTGGAGATGG - Intergenic
1178461175 21:32803711-32803733 CAGTAAGAAAACATTGGGGAGGG - Intronic
1178846413 21:36177546-36177568 CAATTTGACAATATTGGGGTTGG + Intronic
1179375981 21:40850129-40850151 CAGGAAGACAGAACTGGGGAAGG - Intergenic
1180557879 22:16592240-16592262 CAGGCAGAGAATAGTGGGGACGG - Exonic
1182136335 22:27907350-27907372 CAGGATAACTATATTATGGAAGG - Intronic
1182409627 22:30172589-30172611 GATGATGAAAATATTGGGGCTGG + Intronic
1184260268 22:43311130-43311152 CAGGGTGACAGCATTGGGTAGGG - Intronic
949278928 3:2323411-2323433 CAGCATGACAATTTAAGGGACGG - Intronic
951640126 3:24827526-24827548 CAGGTTGACATTTTTTGGGAAGG + Intergenic
952845844 3:37687392-37687414 CATGAGGACTATATTGTGGAAGG + Intronic
953650594 3:44799631-44799653 CAGGATGTCAAGAGTGGGGCAGG - Intronic
957878380 3:86178764-86178786 AAGGAAGACCATATTGAGGAGGG - Intergenic
959515066 3:107256655-107256677 CAAGATGCCAATATTTGGCAAGG + Intergenic
961505984 3:127370878-127370900 CATGATGACCAAATTGGGGCTGG + Intergenic
962742273 3:138370469-138370491 CAGGGTGACAGAAATGGGGAGGG - Intronic
963408620 3:144902131-144902153 CAGGAAGACAATATTAAAGAGGG - Intergenic
963688165 3:148464052-148464074 CTGGGTGTAAATATTGGGGACGG + Intergenic
964225854 3:154400556-154400578 CAGAATGACAATATTGTGGAAGG - Intronic
964671037 3:159226544-159226566 CAAGATGCTAATATTGGGGGAGG + Intronic
965153727 3:165017319-165017341 CAGCATGATAGTATTAGGGAGGG + Intronic
965431548 3:168594917-168594939 AAGGATAACAGTCTTGGGGAAGG - Intergenic
966432698 3:179848958-179848980 GAGGATGACACCCTTGGGGATGG + Intronic
967603750 3:191419447-191419469 CAAGATAACAATAATTGGGATGG + Intergenic
968023284 3:195415174-195415196 CAGGATGTTGATAGTGGGGAAGG + Intronic
969761541 4:9187998-9188020 CAGGATTTCAAGGTTGGGGAAGG + Intergenic
969867023 4:10082879-10082901 CAGGAGAACAATGCTGGGGACGG + Intronic
970343398 4:15130221-15130243 AAGGGTGACAATAATGGAGATGG - Intergenic
970678555 4:18480820-18480842 CAGCATAATAATATTGGGGCTGG + Intergenic
972028165 4:34413420-34413442 TAGGATGACAATACTGATGAAGG - Intergenic
972077173 4:35103158-35103180 CAGGATGACAATAAGGAGTAAGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976970324 4:91095122-91095144 CAGGATGACAATAGGGGGCAAGG - Intronic
981096779 4:140790055-140790077 AAGCATGACAATAATGGGGAGGG + Intergenic
981658290 4:147137192-147137214 CAGGATGGCCACAGTGGGGATGG - Intergenic
982082799 4:151806926-151806948 AAGCATGAAAATATTGGGGAAGG - Intergenic
982093887 4:151903519-151903541 CAGTATAACAAGATTAGGGAAGG - Intergenic
984043257 4:174764057-174764079 CAGATTAACAATATTGGGAAAGG + Intronic
986683514 5:10254799-10254821 CAGGATGATGAAATTGGAGATGG + Exonic
987401217 5:17478819-17478841 CAACATGACAACATTTGGGAAGG + Intergenic
988063163 5:26199940-26199962 CAGGCTGCCCATATTGGTGATGG + Intergenic
989012442 5:36888065-36888087 CAGAATCAAAACATTGGGGAAGG - Intronic
990851519 5:60210618-60210640 CAGGTTAAAAAAATTGGGGAGGG - Intronic
992857818 5:80881282-80881304 CAGGATGTCAATAGTGAGGGAGG - Intergenic
996113624 5:119594357-119594379 CAGAAGGAAAATATTGGGCAGGG + Intronic
1002408485 5:179054758-179054780 CAGGATGACAATAGGGGGCAAGG - Intergenic
1002762801 6:214861-214883 CACCATGGCAATATGGGGGAAGG + Intergenic
1003109456 6:3241355-3241377 CTGGAAGATAATATTGGGGTTGG - Intronic
1004339871 6:14798749-14798771 GAGGCTGAGAATGTTGGGGAGGG - Intergenic
1005125779 6:22444822-22444844 CAGAAGGAGAATATAGGGGAAGG + Intergenic
1006414241 6:33893917-33893939 TAGGATGACAGGATGGGGGAGGG + Intergenic
1007526907 6:42503919-42503941 CAACATGGCAATATTGAGGAGGG - Intergenic
1007969057 6:46032409-46032431 CAGGATAGTAAGATTGGGGAGGG + Intronic
1008673662 6:53796963-53796985 CAGGATGACATTATTGAAGATGG + Intronic
1009474454 6:64071924-64071946 GAGGATGACCAAGTTGGGGAAGG + Intronic
1011007723 6:82666172-82666194 CAAGATGTCAATAGTGGGGGAGG + Intergenic
1021360848 7:19709901-19709923 CAGCATGATAATATTAGGGTGGG - Intergenic
1021511376 7:21436289-21436311 CAGGTTGAGGATATTGGGGCAGG + Intronic
1021810093 7:24394609-24394631 CAAGATGCCAATAGTGGGGGAGG + Intergenic
1022311649 7:29201946-29201968 CTGGAGGATGATATTGGGGAGGG + Intronic
1024531121 7:50393422-50393444 CAGGATGACATGAAGGGGGAAGG + Intronic
1024731950 7:52262847-52262869 CAGTATGACAGTGCTGGGGAAGG - Intergenic
1030175812 7:106651883-106651905 CAGGATGGCAACTGTGGGGAAGG + Intergenic
1031542396 7:123010208-123010230 CAGGATGTTGATAATGGGGAAGG + Intergenic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1031605217 7:123760919-123760941 CAATATTAAAATATTGGGGATGG - Intergenic
1033408539 7:141094237-141094259 CAGGAAGAAAAAATTGGAGATGG + Intronic
1035815595 8:2536515-2536537 CAAGATGACATTATAGGGAATGG - Intergenic
1036271641 8:7309827-7309849 CAGGATTTCAAGGTTGGGGAAGG + Intergenic
1036349708 8:8000523-8000545 CAGGATTTCAAGGTTGGGGAAGG - Intergenic
1037662328 8:20938742-20938764 CAGAATGAAGATCTTGGGGAAGG + Intergenic
1038393010 8:27222849-27222871 CAGGATGAGAATATGGGAGGAGG - Intergenic
1042633087 8:70842855-70842877 CAGGAGGATAATATTGGAGCTGG - Intergenic
1044543025 8:93429087-93429109 CATGATGAAAACATTGGGGTAGG - Intergenic
1046397643 8:113660520-113660542 CGAGATGACAATATTGGTTAAGG + Intergenic
1046652816 8:116857287-116857309 AAGGATGATAATTTTGGAGAAGG - Exonic
1047034011 8:120914624-120914646 CATGATGACAATATGAGGGCTGG + Intergenic
1051860342 9:21617392-21617414 CAGGATGAGAATGATGGGGGCGG + Intergenic
1053040846 9:34870143-34870165 CAGGATGTTGATAGTGGGGAAGG - Intergenic
1053509439 9:38675186-38675208 CAGGATGACACTCTGTGGGAAGG + Intergenic
1055685386 9:78767852-78767874 CAGAATGACCATACTTGGGAGGG - Intergenic
1058201647 9:102049731-102049753 CAGGATGGCAACATTGGAGCAGG - Intergenic
1058296635 9:103315796-103315818 CAGGATGTCAATAGTGGGAAAGG + Intergenic
1060444327 9:123673930-123673952 CTGGATGTCAGTGTTGGGGAGGG - Intronic
1191036339 X:56029549-56029571 CAGGATGACAATAGGGGTCAAGG - Intergenic
1194049548 X:89052523-89052545 GAGAAAGACAATATTTGGGAAGG - Intergenic
1194503468 X:94705290-94705312 GAGAATGACAATGTTAGGGATGG + Intergenic
1195619863 X:106942275-106942297 CAGGATGACCATATGAGGAACGG - Intronic
1195929280 X:110057641-110057663 AAAGATGGCAATATTGGGAAGGG - Intronic
1197652299 X:129078495-129078517 TAGGATGACACTCTAGGGGATGG + Intergenic
1198969770 X:142267817-142267839 CAGGATGACAATAGGGGGCAAGG + Intergenic
1199199558 X:145071220-145071242 CAGGATGAAAAAATTGGGGGAGG - Intergenic
1199652001 X:149954524-149954546 CAAGATGTTAACATTGGGGAAGG - Intergenic
1200911867 Y:8538201-8538223 CAGGATGACAGTCTGGGGCAAGG + Intergenic
1201680817 Y:16642167-16642189 CATGATGACAATAGGGGGCAAGG - Intergenic
1202036971 Y:20645851-20645873 CAGGATGACAATCAGGGGCAAGG + Intergenic