ID: 1064142494

View in Genome Browser
Species Human (GRCh38)
Location 10:12802447-12802469
Sequence CTGTCTTCAGAAATGCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064142486_1064142494 19 Left 1064142486 10:12802405-12802427 CCACAGACAGGGCCATCATTATC 0: 1
1: 0
2: 1
3: 14
4: 125
Right 1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG No data
1064142484_1064142494 27 Left 1064142484 10:12802397-12802419 CCCTTTCTCCACAGACAGGGCCA 0: 1
1: 0
2: 4
3: 26
4: 327
Right 1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG No data
1064142485_1064142494 26 Left 1064142485 10:12802398-12802420 CCTTTCTCCACAGACAGGGCCAT 0: 1
1: 0
2: 2
3: 28
4: 242
Right 1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG No data
1064142489_1064142494 -3 Left 1064142489 10:12802427-12802449 CCTGGCCATTCTCCTCCCATCTG 0: 1
1: 0
2: 3
3: 36
4: 401
Right 1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG No data
1064142490_1064142494 -8 Left 1064142490 10:12802432-12802454 CCATTCTCCTCCCATCTGTCTTC 0: 1
1: 0
2: 2
3: 117
4: 1013
Right 1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG No data
1064142488_1064142494 7 Left 1064142488 10:12802417-12802439 CCATCATTATCCTGGCCATTCTC 0: 1
1: 0
2: 3
3: 16
4: 244
Right 1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064142494 Original CRISPR CTGTCTTCAGAAATGCAGAC TGG Intronic
No off target data available for this crispr