ID: 1064144377

View in Genome Browser
Species Human (GRCh38)
Location 10:12815821-12815843
Sequence CAGGACCTGATGGGCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064144371_1064144377 -8 Left 1064144371 10:12815806-12815828 CCACAGCACCTAGCCCAGGACCT 0: 1
1: 3
2: 45
3: 238
4: 1472
Right 1064144377 10:12815821-12815843 CAGGACCTGATGGGCTGAGCAGG No data
1064144369_1064144377 23 Left 1064144369 10:12815775-12815797 CCACACATGGTGCTTTCTGGGGA No data
Right 1064144377 10:12815821-12815843 CAGGACCTGATGGGCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064144377 Original CRISPR CAGGACCTGATGGGCTGAGC AGG Intronic
No off target data available for this crispr