ID: 1064148497

View in Genome Browser
Species Human (GRCh38)
Location 10:12843663-12843685
Sequence TCTTTGTGCTGACCTGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064148497_1064148501 -5 Left 1064148497 10:12843663-12843685 CCTACAGCAGGTCAGCACAAAGA No data
Right 1064148501 10:12843681-12843703 AAAGAGAGACAGGGGCAGACTGG No data
1064148497_1064148502 -4 Left 1064148497 10:12843663-12843685 CCTACAGCAGGTCAGCACAAAGA No data
Right 1064148502 10:12843682-12843704 AAGAGAGACAGGGGCAGACTGGG No data
1064148497_1064148504 26 Left 1064148497 10:12843663-12843685 CCTACAGCAGGTCAGCACAAAGA No data
Right 1064148504 10:12843712-12843734 TTCCTCACTATGCTCATGGCTGG No data
1064148497_1064148503 22 Left 1064148497 10:12843663-12843685 CCTACAGCAGGTCAGCACAAAGA No data
Right 1064148503 10:12843708-12843730 TCTCTTCCTCACTATGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064148497 Original CRISPR TCTTTGTGCTGACCTGCTGT AGG (reversed) Intergenic
No off target data available for this crispr