ID: 1064149482

View in Genome Browser
Species Human (GRCh38)
Location 10:12850537-12850559
Sequence TTGAATAAGCCAGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064149482_1064149489 29 Left 1064149482 10:12850537-12850559 CCTTCCTCATCTGGCTTATTCAA No data
Right 1064149489 10:12850589-12850611 AATTAGGATGTTTCTGTCTATGG No data
1064149482_1064149486 -7 Left 1064149482 10:12850537-12850559 CCTTCCTCATCTGGCTTATTCAA No data
Right 1064149486 10:12850553-12850575 TATTCAAAGCGGGAATGACCTGG No data
1064149482_1064149488 13 Left 1064149482 10:12850537-12850559 CCTTCCTCATCTGGCTTATTCAA No data
Right 1064149488 10:12850573-12850595 TGGAGAAGAAAGATTTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064149482 Original CRISPR TTGAATAAGCCAGATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr