ID: 1064151744

View in Genome Browser
Species Human (GRCh38)
Location 10:12871370-12871392
Sequence AAGCATTTATAGATGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064151744_1064151746 0 Left 1064151744 10:12871370-12871392 CCAGGAGCCATCTATAAATGCTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1064151746 10:12871393-12871415 ACACATGCTAAAGACCATTGAGG 0: 1
1: 0
2: 2
3: 15
4: 355
1064151744_1064151748 25 Left 1064151744 10:12871370-12871392 CCAGGAGCCATCTATAAATGCTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1064151748 10:12871418-12871440 ACAAGACAGAAACCAGAATCCGG 0: 1
1: 1
2: 2
3: 38
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064151744 Original CRISPR AAGCATTTATAGATGGCTCC TGG (reversed) Intergenic
903357181 1:22755373-22755395 AAACATTTTTAGATGGATGCAGG + Intronic
904873465 1:33636040-33636062 AGTCATTTAAAGGTGGCTCCTGG - Intronic
905013826 1:34763691-34763713 AAGCATTTATTGAAGGCAGCAGG - Exonic
905283909 1:36867074-36867096 GAGCATTTGTATATGGCTGCTGG + Intronic
906350813 1:45057404-45057426 AAGTAAGTAGAGATGGCTCCTGG - Intronic
907346549 1:53786227-53786249 AGGCATTTAGAGATGGCATCTGG - Intronic
908310944 1:62882659-62882681 AAGCATGTACAGATTGCACCTGG + Intergenic
908402468 1:63784485-63784507 AGGCATTTGTAGATGGGACCTGG + Intronic
909274723 1:73668386-73668408 AAGCAGTGACAGATGGCACCTGG - Intergenic
911975071 1:104482134-104482156 AAACAATTATAGATAGCTACAGG - Intergenic
913265654 1:117040887-117040909 TAGCATTTATTGATGGCTTTAGG - Intergenic
916483975 1:165241328-165241350 GTGTATTTATGGATGGCTCCTGG - Intronic
917404965 1:174696165-174696187 AAGCATTTCTAGATCCATCCTGG - Intronic
917410813 1:174758383-174758405 AAACATTTATAGATGAAACCAGG - Intronic
917506473 1:175631949-175631971 TAGCAATGATAGATGCCTCCTGG - Intronic
917985165 1:180309315-180309337 ATGCATTTATAGATAGCAACAGG - Intronic
923304599 1:232676496-232676518 AAGCATTGGTTGATGGCTCAGGG + Intergenic
1064151744 10:12871370-12871392 AAGCATTTATAGATGGCTCCTGG - Intergenic
1067333357 10:45341723-45341745 AAGCATTCACAGATGGCACCTGG + Intergenic
1068480304 10:57580641-57580663 AATCATTTTTAAATGGCTGCGGG + Intergenic
1071162846 10:82771037-82771059 AAGGATTTATCTCTGGCTCCTGG + Intronic
1072940455 10:99759229-99759251 AAGAATGTATAGGTGGCTACAGG + Intergenic
1077889762 11:6410748-6410770 AAGCCCTTACAGATGGCCCCCGG - Exonic
1078709111 11:13773297-13773319 AAACACTTATTGATGGCTCACGG + Intergenic
1080095395 11:28399927-28399949 AAACATTTATTTATGGCTTCAGG - Intergenic
1080290765 11:30668682-30668704 TAGCATTTAGAGATGGATCTAGG - Intergenic
1080955660 11:37092053-37092075 AAACATTGTTAGATGTCTCCTGG + Intergenic
1081719486 11:45277451-45277473 AAACATTTATTAATGTCTCCAGG - Intronic
1082613859 11:55335171-55335193 AAGCCGTGATAGATGGCACCTGG - Intergenic
1082760816 11:57125151-57125173 AGGTATTTATAGACTGCTCCTGG + Intergenic
1085225846 11:74920499-74920521 AAGCAGTCAGAGAAGGCTCCTGG + Intronic
1085525468 11:77161192-77161214 AAGCACATTTAGTTGGCTCCTGG + Intronic
1087488238 11:98787043-98787065 GAGCATTTAGATATGGCTCAAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089550851 11:119276104-119276126 AAGCACTGATTGATGGCTTCAGG + Exonic
1093574537 12:20711723-20711745 AAGCATTAATTGATAGTTCCTGG + Intronic
1098323231 12:69272732-69272754 AAACATTTACAGAGGGCTACGGG - Exonic
1099795429 12:87394185-87394207 AAGCAGTGACAGATGGCACCTGG + Intergenic
1100955692 12:99905431-99905453 AAGCATTCATAAATGGCTCTTGG + Intronic
1101060183 12:100962994-100963016 AAGAAGTTAAAGATGGCTCCTGG + Intronic
1102602488 12:114042567-114042589 AAACATGTCTGGATGGCTCCTGG - Intergenic
1104319426 12:127736340-127736362 CAGCATTTATATCTGGCTCCAGG + Intergenic
1106139817 13:27002829-27002851 AAACATTCACAGATGGCTACAGG + Intergenic
1110199016 13:72826659-72826681 AAGAATGTATACATGGCTCTAGG - Intronic
1110967551 13:81719165-81719187 AGGCATTTATAAGTGGCTCGGGG - Intergenic
1112422266 13:99263270-99263292 AAGGTTTTATAGCTGGATCCTGG + Intronic
1114240244 14:20860355-20860377 AAGCCTTCAAAGATGGCACCTGG + Intergenic
1115170207 14:30496368-30496390 AAGCATATATAGATGGATGATGG + Intergenic
1120107790 14:80516236-80516258 TAACATTTCTAGATGGATCCTGG - Intronic
1129800620 15:78411118-78411140 AAGACTTTATAAAAGGCTCCAGG - Intergenic
1132034040 15:98465299-98465321 CAGCATTTATAAAAGGCTGCTGG - Intronic
1132407252 15:101551363-101551385 AAGAATCCACAGATGGCTCCTGG + Intergenic
1136991872 16:35157633-35157655 AAGCATTGACAGATGGCACCTGG + Intergenic
1144188517 17:12820924-12820946 AAGAATGGATAGATGTCTCCTGG + Intronic
1148241368 17:46001495-46001517 CAGCATTAAGAGCTGGCTCCTGG + Intronic
1154397720 18:14006691-14006713 AAGCTGTTACAGATGGCACCTGG - Intergenic
1155394567 18:25373473-25373495 AAGCATTAATAGATGGTCCCAGG - Intergenic
1157254764 18:46128909-46128931 AAGCACTTATTTATGGCACCTGG - Intergenic
1159844889 18:73447184-73447206 AAGCATTTATAGATACTTCTTGG + Intergenic
1159901362 18:74049980-74050002 AGGTATTGATAGATGACTCCTGG - Intergenic
1160249540 18:77189502-77189524 AAATATTGATAAATGGCTCCTGG - Intergenic
1160628535 18:80229535-80229557 GAGCATTTCCAGCTGGCTCCAGG - Intronic
1167280455 19:48564761-48564783 AAGGATTGATAGATGGCTAGAGG - Intronic
925255539 2:2483452-2483474 AAGCATTTATAGATTGCCTGAGG - Intergenic
930466763 2:51762905-51762927 AACCTTTAATACATGGCTCCTGG + Intergenic
933273269 2:80256479-80256501 AAGGATTTCTAGAAGGATCCTGG - Intronic
937646991 2:124276667-124276689 AAGGATTTATAGATGAATCGTGG - Intronic
937647693 2:124284302-124284324 AACCATTTCTAGATGGGTCAGGG + Intronic
939121248 2:138120109-138120131 AAACATTTTTACATGGCTTCTGG + Intergenic
939952420 2:148490798-148490820 AAGCATTTATAGATCACACTAGG + Intronic
943125261 2:183788868-183788890 AAGCAGTGACAGATGGCACCTGG + Intergenic
945247429 2:207731652-207731674 AAGCAATTATAGCTGGCAACAGG - Intronic
945896113 2:215483429-215483451 AAATATTTATAGATCACTCCAGG + Intergenic
1168799645 20:635824-635846 AAGCCTTTCTTGATTGCTCCAGG + Intergenic
1169430942 20:5535671-5535693 AAGGATTTAAAAATGACTCCCGG + Intergenic
1169801958 20:9519726-9519748 AAGCATTTATGGCAGGGTCCTGG - Intronic
1170802527 20:19602212-19602234 TAACATGTATTGATGGCTCCTGG + Intronic
1170898898 20:20441000-20441022 AATAATTTATACATGGATCCTGG + Intronic
1175231276 20:57474974-57474996 AAGGACTCTTAGATGGCTCCAGG + Intergenic
1179065597 21:38021611-38021633 CAGCATTTCTAATTGGCTCCTGG - Intronic
950140161 3:10609748-10609770 CAGCATCTTTAGATGGCTCAGGG + Intronic
950506505 3:13398062-13398084 AAGCATTTTTATATGGTACCTGG - Intronic
951765122 3:26189361-26189383 AAGCAGCTAGAGATGGCTACTGG + Intergenic
954708619 3:52494100-52494122 AAGCATTTACAGATGGCCACCGG + Intergenic
955876709 3:63498249-63498271 AATAATTTATAAATGGTTCCTGG + Intronic
957106671 3:75897845-75897867 AGCCATTTATAGAAGGCTTCAGG + Intergenic
958116503 3:89226001-89226023 AAACATTTATTGATGTCTCAAGG - Intronic
959807644 3:110576520-110576542 AAATATTTACAGATGGCACCAGG - Intergenic
961956012 3:130804872-130804894 AAGCAGTGACAGATGGCACCTGG + Intergenic
964692364 3:159464559-159464581 AAGCATTTATAAAAGGTTCATGG + Intronic
971842208 4:31868091-31868113 AAGCATTTACATCTGGTTCCAGG + Intergenic
973667506 4:53177760-53177782 AAGCAGTGACAGATGGCACCTGG + Intronic
973942135 4:55921937-55921959 AAACATTTATTGATGGCTTATGG + Intergenic
978549980 4:109915013-109915035 GAGCTTTTATGGATGGCTCTAGG + Intronic
979564107 4:122134726-122134748 AAGCATTTTTCTCTGGCTCCTGG - Intergenic
980300444 4:130984428-130984450 AACTTTTTATAGATGCCTCCTGG + Intergenic
981819017 4:148864565-148864587 AACAATTGATAGATGGCTCATGG - Intergenic
982250388 4:153400263-153400285 AACCATGTAAAGATGGATCCTGG + Intronic
983427953 4:167610540-167610562 AAGACTTTATAGATGGCTGTAGG - Intergenic
984879061 4:184394598-184394620 AAGCCTTTACTGATGGCTGCTGG + Intronic
985823988 5:2179534-2179556 AGCCATTTACAGAAGGCTCCCGG + Intergenic
988480487 5:31626394-31626416 AAGCATTCCCAGATGGCTCCTGG - Intergenic
989149923 5:38289195-38289217 AAGGAATTAAAGATGACTCCAGG - Intronic
990062092 5:51663636-51663658 AAACATTGATAAATGGCTCCAGG + Intergenic
990482143 5:56221603-56221625 AAGCAGTGACAGATGGCACCTGG + Intronic
993818070 5:92577942-92577964 TTGCATGTATAGATGGCTCTGGG - Intergenic
995450811 5:112298194-112298216 ATGAATTTATAGATTGCTTCTGG + Intronic
997836974 5:137202547-137202569 CAGCATGTATAAATGCCTCCAGG + Intronic
1003785581 6:9482624-9482646 AAGCATTAATAGGTGGCTGGTGG - Intergenic
1007697215 6:43741298-43741320 AAGCATTTGTAATTGGCTCCTGG + Intergenic
1007928027 6:45665576-45665598 CAGCATTTCTAGACAGCTCCAGG + Intergenic
1007984139 6:46190503-46190525 AAGGATGTAGAGATGGCTTCTGG + Intergenic
1009056552 6:58342636-58342658 AAGCAGTGACAGATGGCACCTGG - Intergenic
1009282398 6:61769419-61769441 AAGCAGTGACAGATGGCACCTGG + Intronic
1010553489 6:77251764-77251786 AAGCAGTGACAGATGGCACCTGG + Intergenic
1010675307 6:78736561-78736583 AAGCTATGATAGATGGCACCTGG + Intergenic
1011408291 6:87039069-87039091 AAGCAGTGACAGATGGCACCTGG - Intergenic
1012905944 6:105065776-105065798 AAGCATTTATAGAGGGCCAGTGG - Intronic
1013924651 6:115455804-115455826 TAGCTTTTATAGATAGATCCTGG - Intergenic
1018472848 6:164111962-164111984 ACACATTTCAAGATGGCTCCAGG + Intergenic
1019745458 7:2697843-2697865 AAGAAGTTATAGAAAGCTCCAGG + Intronic
1022237555 7:28476733-28476755 AAGAATTAAAAGATTGCTCCAGG + Intronic
1022655577 7:32316741-32316763 AAGCAGTTATAGTTGGCAGCAGG + Intergenic
1023682614 7:42703070-42703092 AAGCTTTTATATATAGTTCCTGG + Intergenic
1025032534 7:55569670-55569692 AAACATTCATAGAGTGCTCCAGG - Intronic
1026191571 7:68133310-68133332 AAGTGTTTATAGCTGTCTCCAGG - Intergenic
1031973384 7:128079230-128079252 AAGCATTTATGGCTCTCTCCTGG + Intronic
1032603718 7:133327091-133327113 AAGCAGTGATGGATGGCACCTGG - Intronic
1034687046 7:152981296-152981318 AAGCATAAATAGAAGGGTCCTGG - Intergenic
1038902962 8:31864671-31864693 AAACATTTTTAAATGGCTACAGG - Intronic
1041175885 8:55195931-55195953 ATGGTTTTATAGATGTCTCCGGG + Intronic
1042339995 8:67668702-67668724 AAGCATTTTTAAATGCCTTCTGG + Intronic
1042366878 8:67947322-67947344 AAAGATTTAGAGATGGGTCCAGG + Intergenic
1042748037 8:72128535-72128557 AATCATTTGTTGATGGCTCTAGG + Intergenic
1044295301 8:90519886-90519908 AAGCATTAATAGAAGGCCTCAGG - Intergenic
1048786975 8:138060943-138060965 AAGCATTTCTCTATGGCTACTGG - Intergenic
1050955768 9:11657394-11657416 AAACATGTATAGAAGGGTCCAGG - Intergenic
1052182325 9:25544984-25545006 AATCACTTATAAATGGCTGCAGG + Intergenic
1055584072 9:77738015-77738037 GAGCATTTAATGTTGGCTCCAGG + Intronic
1055690003 9:78819777-78819799 CAGCATTTATAGATGCCTCAGGG + Intergenic
1059374209 9:113869735-113869757 GAGCATTTATTGTTGACTCCTGG + Intergenic
1060502279 9:124169278-124169300 ATACATTTATAGATGACCCCTGG - Intergenic
1190141541 X:47850142-47850164 GAGCATTTATACATGTGTCCTGG - Intronic
1192401299 X:70838742-70838764 AAGCAGTGACAGATGGCACCTGG + Intronic
1192674857 X:73185092-73185114 AAGCTGTGATAGATGGCACCTGG + Intergenic
1193010962 X:76674654-76674676 AAGCAGTGACAGATGGCACCTGG + Intergenic
1193582764 X:83285720-83285742 AAGCAGTGACAGATGGCACCGGG - Intergenic
1193582862 X:83286540-83286562 AAGCAGTGACAGATGGCACCTGG + Intergenic
1193658447 X:84226190-84226212 CAGCATTTTTAGATGGCTAGTGG - Intergenic
1194575354 X:95606827-95606849 AAGCATATATACATGTCTTCAGG - Intergenic
1195655590 X:107328742-107328764 AAGCATTTAAAAATGCCACCAGG - Intergenic
1195856232 X:109335704-109335726 AAGCAGTGACAGATGGCACCTGG - Intergenic
1198730422 X:139722069-139722091 AAGTATTAATATATGGCACCAGG - Intergenic