ID: 1064153680

View in Genome Browser
Species Human (GRCh38)
Location 10:12886325-12886347
Sequence TAAGGGCTTGATCTGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064153680_1064153686 -4 Left 1064153680 10:12886325-12886347 CCTTATTCCAGATCAAGCCCTTA No data
Right 1064153686 10:12886344-12886366 CTTAGCCCAAGGCCAGAAATGGG No data
1064153680_1064153691 15 Left 1064153680 10:12886325-12886347 CCTTATTCCAGATCAAGCCCTTA No data
Right 1064153691 10:12886363-12886385 TGGGTTTTTAAAGATGGCATAGG No data
1064153680_1064153694 30 Left 1064153680 10:12886325-12886347 CCTTATTCCAGATCAAGCCCTTA No data
Right 1064153694 10:12886378-12886400 GGCATAGGGAGCAATTATCAGGG No data
1064153680_1064153693 29 Left 1064153680 10:12886325-12886347 CCTTATTCCAGATCAAGCCCTTA No data
Right 1064153693 10:12886377-12886399 TGGCATAGGGAGCAATTATCAGG No data
1064153680_1064153685 -5 Left 1064153680 10:12886325-12886347 CCTTATTCCAGATCAAGCCCTTA No data
Right 1064153685 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
1064153680_1064153690 9 Left 1064153680 10:12886325-12886347 CCTTATTCCAGATCAAGCCCTTA No data
Right 1064153690 10:12886357-12886379 CAGAAATGGGTTTTTAAAGATGG No data
1064153680_1064153692 16 Left 1064153680 10:12886325-12886347 CCTTATTCCAGATCAAGCCCTTA No data
Right 1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064153680 Original CRISPR TAAGGGCTTGATCTGGAATA AGG (reversed) Intergenic
No off target data available for this crispr