ID: 1064153684

View in Genome Browser
Species Human (GRCh38)
Location 10:12886343-12886365
Sequence CCATTTCTGGCCTTGGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064153684_1064153695 19 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153695 10:12886385-12886407 GGAGCAATTATCAGGGAGTGTGG No data
1064153684_1064153694 12 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153694 10:12886378-12886400 GGCATAGGGAGCAATTATCAGGG No data
1064153684_1064153693 11 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153693 10:12886377-12886399 TGGCATAGGGAGCAATTATCAGG No data
1064153684_1064153691 -3 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153691 10:12886363-12886385 TGGGTTTTTAAAGATGGCATAGG No data
1064153684_1064153690 -9 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153690 10:12886357-12886379 CAGAAATGGGTTTTTAAAGATGG No data
1064153684_1064153692 -2 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG No data
1064153684_1064153696 22 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153696 10:12886388-12886410 GCAATTATCAGGGAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064153684 Original CRISPR CCATTTCTGGCCTTGGGCTA AGG (reversed) Intergenic
No off target data available for this crispr