ID: 1064153692

View in Genome Browser
Species Human (GRCh38)
Location 10:12886364-12886386
Sequence GGGTTTTTAAAGATGGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064153684_1064153692 -2 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG No data
1064153680_1064153692 16 Left 1064153680 10:12886325-12886347 CCTTATTCCAGATCAAGCCCTTA No data
Right 1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG No data
1064153683_1064153692 -1 Left 1064153683 10:12886342-12886364 CCCTTAGCCCAAGGCCAGAAATG No data
Right 1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG No data
1064153688_1064153692 -9 Left 1064153688 10:12886350-12886372 CCAAGGCCAGAAATGGGTTTTTA No data
Right 1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG No data
1064153681_1064153692 9 Left 1064153681 10:12886332-12886354 CCAGATCAAGCCCTTAGCCCAAG No data
Right 1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG No data
1064153687_1064153692 -8 Left 1064153687 10:12886349-12886371 CCCAAGGCCAGAAATGGGTTTTT No data
Right 1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064153692 Original CRISPR GGGTTTTTAAAGATGGCATA GGG Intergenic
No off target data available for this crispr