ID: 1064153695

View in Genome Browser
Species Human (GRCh38)
Location 10:12886385-12886407
Sequence GGAGCAATTATCAGGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064153684_1064153695 19 Left 1064153684 10:12886343-12886365 CCTTAGCCCAAGGCCAGAAATGG No data
Right 1064153695 10:12886385-12886407 GGAGCAATTATCAGGGAGTGTGG No data
1064153689_1064153695 6 Left 1064153689 10:12886356-12886378 CCAGAAATGGGTTTTTAAAGATG No data
Right 1064153695 10:12886385-12886407 GGAGCAATTATCAGGGAGTGTGG No data
1064153683_1064153695 20 Left 1064153683 10:12886342-12886364 CCCTTAGCCCAAGGCCAGAAATG No data
Right 1064153695 10:12886385-12886407 GGAGCAATTATCAGGGAGTGTGG No data
1064153681_1064153695 30 Left 1064153681 10:12886332-12886354 CCAGATCAAGCCCTTAGCCCAAG No data
Right 1064153695 10:12886385-12886407 GGAGCAATTATCAGGGAGTGTGG No data
1064153687_1064153695 13 Left 1064153687 10:12886349-12886371 CCCAAGGCCAGAAATGGGTTTTT No data
Right 1064153695 10:12886385-12886407 GGAGCAATTATCAGGGAGTGTGG No data
1064153688_1064153695 12 Left 1064153688 10:12886350-12886372 CCAAGGCCAGAAATGGGTTTTTA No data
Right 1064153695 10:12886385-12886407 GGAGCAATTATCAGGGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064153695 Original CRISPR GGAGCAATTATCAGGGAGTG TGG Intergenic
No off target data available for this crispr