ID: 1064153697

View in Genome Browser
Species Human (GRCh38)
Location 10:12886400-12886422
Sequence GAGTGTGGAGGCAAACAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064153687_1064153697 28 Left 1064153687 10:12886349-12886371 CCCAAGGCCAGAAATGGGTTTTT No data
Right 1064153697 10:12886400-12886422 GAGTGTGGAGGCAAACAACATGG No data
1064153689_1064153697 21 Left 1064153689 10:12886356-12886378 CCAGAAATGGGTTTTTAAAGATG No data
Right 1064153697 10:12886400-12886422 GAGTGTGGAGGCAAACAACATGG No data
1064153688_1064153697 27 Left 1064153688 10:12886350-12886372 CCAAGGCCAGAAATGGGTTTTTA No data
Right 1064153697 10:12886400-12886422 GAGTGTGGAGGCAAACAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064153697 Original CRISPR GAGTGTGGAGGCAAACAACA TGG Intergenic
No off target data available for this crispr