ID: 1064155905

View in Genome Browser
Species Human (GRCh38)
Location 10:12902966-12902988
Sequence GTGAATGTGAAAAGCGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064155898_1064155905 26 Left 1064155898 10:12902917-12902939 CCGGAGTGGGAGGATCATTGAGA 0: 1
1: 0
2: 2
3: 44
4: 315
Right 1064155905 10:12902966-12902988 GTGAATGTGAAAAGCGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064155905 Original CRISPR GTGAATGTGAAAAGCGTGGA TGG Intronic
No off target data available for this crispr