ID: 1064156193

View in Genome Browser
Species Human (GRCh38)
Location 10:12905362-12905384
Sequence CTTGTAAAGGGCCAGATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 228}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064156193_1064156200 16 Left 1064156193 10:12905362-12905384 CCTAAAATCTGGCCCTTTACAAG 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1064156200 10:12905401-12905423 TTAACCTCAAGAGGGGCTCAAGG No data
1064156193_1064156199 9 Left 1064156193 10:12905362-12905384 CCTAAAATCTGGCCCTTTACAAG 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1064156199 10:12905394-12905416 CTGAATCTTAACCTCAAGAGGGG No data
1064156193_1064156202 26 Left 1064156193 10:12905362-12905384 CCTAAAATCTGGCCCTTTACAAG 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1064156202 10:12905411-12905433 GAGGGGCTCAAGGCAAACGCAGG No data
1064156193_1064156198 8 Left 1064156193 10:12905362-12905384 CCTAAAATCTGGCCCTTTACAAG 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1064156198 10:12905393-12905415 GCTGAATCTTAACCTCAAGAGGG No data
1064156193_1064156197 7 Left 1064156193 10:12905362-12905384 CCTAAAATCTGGCCCTTTACAAG 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1064156197 10:12905392-12905414 TGCTGAATCTTAACCTCAAGAGG No data
1064156193_1064156203 29 Left 1064156193 10:12905362-12905384 CCTAAAATCTGGCCCTTTACAAG 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1064156203 10:12905414-12905436 GGGCTCAAGGCAAACGCAGGTGG No data
1064156193_1064156204 30 Left 1064156193 10:12905362-12905384 CCTAAAATCTGGCCCTTTACAAG 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1064156204 10:12905415-12905437 GGCTCAAGGCAAACGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064156193 Original CRISPR CTTGTAAAGGGCCAGATTTT AGG (reversed) Intronic
901213980 1:7543894-7543916 CATGGAAAGGGACAGATTCTGGG + Intronic
901882177 1:12200426-12200448 TCTGTAAAGGGCCAGATGGTAGG + Intronic
902046492 1:13528618-13528640 CCTGTAATGGGCCAGATGCTGGG - Intergenic
902546887 1:17195799-17195821 CTTGGAAAGGGCCAGGGTTGGGG - Intergenic
902965391 1:19997427-19997449 CCAGTATATGGCCAGATTTTGGG - Intergenic
902966005 1:20003231-20003253 CCAGTATATGGCCAGATTTTGGG - Intergenic
904445086 1:30565656-30565678 GTTGTAAAGGTGCAAATTTTTGG + Intergenic
905747631 1:40432507-40432529 ATTGAAAATGGACAGATTTTAGG - Intergenic
905940602 1:41860257-41860279 CTTGTCAAGGGGGAGATTTAAGG - Intronic
911240482 1:95459962-95459984 CTGCTAAAGTGCCATATTTTGGG + Intergenic
911989293 1:104671904-104671926 CACGTAAAGGGCCTGATTTACGG - Intergenic
913165018 1:116177193-116177215 CTTGTAAAAGCCCAGATTGCTGG - Intergenic
913188178 1:116389302-116389324 CTTTTTAAGGGCCAGCTCTTTGG - Intronic
913202504 1:116506650-116506672 CTTTTAAACAACCAGATTTTGGG - Intergenic
913345856 1:117810579-117810601 CTTGTAAAGCACCTGCTTTTGGG + Intergenic
914464621 1:147915562-147915584 CTGGTCAAGGGTCAGGTTTTTGG + Intergenic
917293248 1:173493105-173493127 CCAGTTAATGGCCAGATTTTGGG - Intergenic
917853782 1:179085871-179085893 CTTGTACAGGTCCACATATTTGG - Exonic
919190652 1:194213690-194213712 CTAGTAAATGGCAAGATTTATGG - Intergenic
1064156193 10:12905362-12905384 CTTGTAAAGGGCCAGATTTTAGG - Intronic
1064184856 10:13152763-13152785 CTTTTAAAAGGCCAGACTCTCGG - Intergenic
1066682750 10:37950149-37950171 TTTGTAAAGTGCTAGATCTTAGG + Exonic
1066973679 10:42343093-42343115 TTTGTAAAGGGCCAGAAAATGGG + Intergenic
1069204635 10:65666540-65666562 ATTGTTAAGTGCCAGTTTTTAGG + Intergenic
1071307184 10:84309761-84309783 TTTGTCAAGGGCCAGAGTCTAGG + Intergenic
1073912967 10:108368094-108368116 TTTGTAAAAGGCCAGATATTAGG - Intergenic
1074217414 10:111399252-111399274 CTTTTAAAGGACCAGATCTCAGG - Intergenic
1079701971 11:23559254-23559276 TTAGTAAAGGGCCATATTCTGGG - Intergenic
1080517928 11:33040432-33040454 CTAGTAAAGAGCCAGAATTGGGG + Intronic
1080565518 11:33505784-33505806 CTTTTTTATGGCCAGATTTTTGG + Intergenic
1081623056 11:44630501-44630523 CTTTTAAAAGCCCAGATTTCCGG - Intergenic
1083891949 11:65599922-65599944 CTTGTGAAAGGCCAGAATGTGGG - Intronic
1085341871 11:75736825-75736847 GTGGTAAACGACCAGATTTTTGG + Intergenic
1085355623 11:75834001-75834023 CCAGTTAATGGCCAGATTTTGGG + Intronic
1086729206 11:90227397-90227419 CTGGCAAAGGTCAAGATTTTAGG - Intergenic
1087051642 11:93891632-93891654 CTTATGAAGGGCCAGATAATAGG - Intergenic
1089989702 11:122847707-122847729 CATGCAAAGGGGCATATTTTTGG + Intronic
1090028175 11:123185343-123185365 CTTGTTAAGTGCCAGATCTGAGG + Intronic
1091260953 11:134233748-134233770 CTTGTGCAGGGCCAGGTTCTAGG + Intronic
1092035365 12:5329881-5329903 CTTATTAAGAGCCAGATTTGGGG + Intergenic
1092699271 12:11209116-11209138 CTTGTAAAATGCCACATTTCAGG + Intergenic
1093422481 12:18990726-18990748 CTTGTAAAGGACCAGAGGTCAGG - Intergenic
1093641791 12:21535478-21535500 TTTGTCAAAGGCTAGATTTTAGG + Intronic
1093801241 12:23375731-23375753 CATGTCAAGGGCTCGATTTTGGG - Intergenic
1095736868 12:45567177-45567199 GTTGTAAATGGCCAGCTGTTAGG - Intergenic
1095975085 12:47934950-47934972 CCTGGAAAGGGTCACATTTTCGG - Intronic
1096482852 12:51953540-51953562 CTTATTAAGGGCCATGTTTTTGG + Intronic
1100908681 12:99332924-99332946 CTTGACAGGGGCCAGATTTAGGG + Intronic
1101206744 12:102495966-102495988 GTTGGAAAAGGCCAGATGTTGGG - Intergenic
1101767057 12:107711372-107711394 TTTGTTTATGGCCAGATTTTGGG + Intronic
1103817733 12:123671940-123671962 CTTGTAAAGGGCCCAATCTTAGG + Intronic
1105229298 13:18474805-18474827 TTTGTAAAGGGCCAGAAAATGGG + Intergenic
1107207235 13:37807351-37807373 CTTGTAAATATCCATATTTTAGG - Intronic
1108893713 13:55295602-55295624 CTTTTAAATGACCAGATCTTTGG - Intergenic
1109391097 13:61694816-61694838 CTTTTAAACAACCAGATTTTGGG - Intergenic
1110962639 13:81648835-81648857 GTTATAAATGCCCAGATTTTTGG + Intergenic
1111195296 13:84868622-84868644 CTTGTAAAGGACAAGATATGGGG + Intergenic
1111291619 13:86178465-86178487 CTTTTAAAGGACCAGATCTCAGG + Intergenic
1111608049 13:90565909-90565931 CTTTTGTAGGTCCAGATTTTAGG + Intergenic
1111747468 13:92288819-92288841 GTTATCAAGGGCCAAATTTTAGG - Intronic
1112107301 13:96254588-96254610 TTTGTAAAGGGCCAGGCTTTTGG - Intronic
1113245179 13:108387518-108387540 TTTGGAAATGGCTAGATTTTTGG + Intergenic
1113746407 13:112747961-112747983 CTTGAAAAGTTTCAGATTTTTGG - Intronic
1114028891 14:18557707-18557729 CCTGTTTATGGCCAGATTTTGGG + Intergenic
1114255162 14:20995519-20995541 CTTTTAAAGGGCCAGAGAGTAGG - Intronic
1115024878 14:28732388-28732410 TTTATAAAGTGCCTGATTTTTGG - Intergenic
1117788064 14:59308335-59308357 CTTGTAAAAGGGAAGATTTGGGG + Intronic
1118231466 14:63954385-63954407 CTTTTAAAGGCACAGATTTCAGG + Intronic
1120316644 14:82902737-82902759 CTTGTCATGGGACAAATTTTGGG + Intergenic
1121708927 14:96022413-96022435 CTTGGAAAGGGGCTGATTTAGGG - Intergenic
1124880540 15:33638407-33638429 CTGGAAAAGGCCCTGATTTTTGG - Intronic
1126568445 15:50125132-50125154 CTTGTAAATGCCCTGATTGTTGG - Intronic
1127704438 15:61533146-61533168 CTTGTAAAGAGGTAGAGTTTAGG + Intergenic
1127821599 15:62662124-62662146 TTTTTAAAGAGCCAGCTTTTGGG - Intronic
1128313677 15:66646957-66646979 CTTGCAAAGGTCCAGCTGTTAGG + Intronic
1129781295 15:78273564-78273586 TCTGTAAAGAGCCAGATTTTAGG + Intronic
1131020261 15:89091668-89091690 TTTTAAAAGAGCCAGATTTTAGG - Intronic
1134623500 16:15707536-15707558 CTTGTTAAGAGCCAGTTTTGTGG - Intronic
1134822130 16:17255433-17255455 TCTGTGAAGGGCCAGATCTTAGG - Intronic
1136046819 16:27621804-27621826 CTTGTAAATGGCCAGATCTTGGG + Intronic
1137328894 16:47470540-47470562 CTGGTTTATGGCCAGATTTTGGG + Intronic
1137534710 16:49311130-49311152 CTTGTGATGGGCCAGACTTTTGG - Intergenic
1138012406 16:53394808-53394830 CGGGTAAAGGGCCAGAGTTCAGG + Intergenic
1138699102 16:58844957-58844979 CTTTTAAAGGCCCACATTTCTGG + Intergenic
1141046771 16:80722668-80722690 TTTGAAAAGGGCCTGGTTTTCGG - Intronic
1141822388 16:86455621-86455643 TTTCCAAAGGGCCAGATGTTTGG + Intergenic
1145116085 17:20211679-20211701 CTTGAAAAGGGGCAGAAGTTTGG + Intronic
1149137518 17:53387003-53387025 CTTAAAAAGTGTCAGATTTTGGG - Intergenic
1149497766 17:57131078-57131100 CTTGGAGAGGGCTAGATTTCAGG + Intergenic
1151858780 17:76742900-76742922 CTTGTCAAGGCCAAAATTTTAGG - Intronic
1153134811 18:1903485-1903507 CTAGTTTATGGCCAGATTTTGGG + Intergenic
1153507357 18:5814813-5814835 CTTGTAAAAGCACAGATTTCTGG - Intergenic
1154524153 18:15265318-15265340 TTTGTAAAGGGCCAGAAAATGGG - Intergenic
1155647349 18:28095124-28095146 CTTGTAAATGGCCAGGCTTCAGG + Intronic
1156048187 18:32900843-32900865 TTTGTAAAAGGCCAGAGATTGGG + Intergenic
1158893394 18:61893601-61893623 GCTGTGAAGGGCCAGATGTTGGG - Exonic
1159330248 18:66984624-66984646 CTTTCAAAGGACTAGATTTTGGG + Intergenic
1160417157 18:78719483-78719505 TATGTAAAGTGCCATATTTTGGG - Intergenic
1164024502 19:21338851-21338873 CCAGTATATGGCCAGATTTTGGG + Intergenic
1167837680 19:52087652-52087674 CTTGAAATGGGCCAGGTTTAGGG + Intronic
1168366680 19:55793958-55793980 CCTGTAAAAGGCCAAATTTATGG - Intronic
928065613 2:28161564-28161586 CTTGAAAAGGGGAAGAGTTTGGG - Intronic
928445303 2:31328897-31328919 CTTTTAAAAGGCCAGATGCTGGG - Intergenic
928671724 2:33609896-33609918 TTTGTTTATGGCCAGATTTTGGG - Intergenic
930693290 2:54386341-54386363 GTTGAAAATGGCCAGATTTGGGG + Intergenic
931071570 2:58657394-58657416 CTTTAAAAGGGCAAGAATTTTGG + Intergenic
931900216 2:66780116-66780138 CTTTTAAATGGCCAGATCTCAGG + Intergenic
933500965 2:83110210-83110232 CCAGTTAATGGCCAGATTTTGGG + Intergenic
937070269 2:119057746-119057768 CTGTTAAAGGGGCAGATGTTGGG + Intergenic
938523399 2:132097825-132097847 TTTGTAAAGGGCCAGAAAATGGG - Intergenic
941528372 2:166633182-166633204 ATTGTAAATCGCCTGATTTTTGG + Intergenic
942848761 2:180457681-180457703 CTTCTAAAGGTTTAGATTTTTGG - Intergenic
945137483 2:206643972-206643994 CTTGTAAAGGAACACATCTTAGG + Intergenic
946206441 2:218112272-218112294 CCAGTTAATGGCCAGATTTTGGG - Intergenic
946369850 2:219274228-219274250 CTTCTTTGGGGCCAGATTTTGGG + Intronic
948831436 2:240600258-240600280 CTTTTAAATGACCAGATCTTAGG + Intronic
1170552277 20:17488447-17488469 TCTGTAAAGGGCCAGATTGTAGG - Intergenic
1172049988 20:32109941-32109963 CTTGTGAAGGCCCCGAGTTTTGG + Intronic
1173146769 20:40531593-40531615 CTTCTTAAGTGCCAGATTCTAGG + Intergenic
1174913099 20:54627705-54627727 CTTGTAAAGCCACAGATTTCGGG + Intronic
1176587479 21:8602320-8602342 CATGTTAAGGTCCAGATATTTGG - Intergenic
1176773288 21:13103159-13103181 TTTGTAAAGGGCCAGAAAATGGG + Intergenic
1178765001 21:35442183-35442205 CTTGTAAAGATCCAGATTGCAGG + Intronic
1180270310 22:10579317-10579339 CATGTTAAGGTCCAGATATTTGG - Intergenic
1180453010 22:15484769-15484791 CCTGTTTATGGCCAGATTTTGGG + Intergenic
1180520919 22:16202872-16202894 TTTGTAAAGGGCCAGAAAATGGG + Intergenic
1181172896 22:21020030-21020052 TTTGTTTATGGCCAGATTTTGGG + Intronic
1182418430 22:30236282-30236304 CTTGTAATGAGGCAGATTTAAGG + Intergenic
1184753207 22:46500891-46500913 CATGTAAATGGGCTGATTTTCGG - Intronic
949139881 3:619433-619455 CATGTTAAGGTCCAGATATTTGG + Intergenic
951821931 3:26823472-26823494 TTTGTTTATGGCCAGATTTTGGG + Intergenic
953573891 3:44097375-44097397 CTTGCATATGGCCCGATTTTAGG - Intergenic
954571525 3:51645015-51645037 CTTTTAAAGGGCCGGATGCTTGG + Exonic
956264748 3:67384511-67384533 TCTGTAAAGGGCAGGATTTTAGG - Intronic
958476833 3:94594851-94594873 GTCGTAAAGGGCCAGAATTTAGG - Intergenic
959618631 3:108376086-108376108 GTATTAAAGGGCCATATTTTAGG + Intronic
960331913 3:116370355-116370377 CTGGTAAAGGGACAGATTTCTGG - Intronic
960552273 3:118989246-118989268 CTGGTCCAGGGCCACATTTTGGG - Intronic
961472244 3:127122875-127122897 CTTGGAAAGAACAAGATTTTAGG + Intergenic
963415126 3:144984873-144984895 CTAGTTTATGGCCAGATTTTGGG + Intergenic
963500299 3:146117301-146117323 CTGGTAAAGGTCCAGAATTCAGG - Intronic
964578698 3:158205709-158205731 TTTGTAAAGGGCTAGATTAGGGG + Intronic
964851747 3:161103354-161103376 CTTGTAAAGGGCATTATTATGGG + Intronic
964970133 3:162550068-162550090 CTTATATAGGGCCAGAATCTCGG - Intergenic
965030739 3:163363679-163363701 CTTTTAAATGACCAGATTTCAGG + Intergenic
966641171 3:182192119-182192141 CTTTTAAATGACCAGATCTTAGG - Intergenic
967941707 3:194771459-194771481 TTTGGAAAAGGCCAGACTTTTGG + Intergenic
969886183 4:10217562-10217584 CTTCTAAAGAGCCAGATCTAAGG + Intergenic
971330553 4:25677893-25677915 CCTGCAAAGCTCCAGATTTTTGG + Exonic
972460628 4:39298951-39298973 TTTGTTTATGGCCAGATTTTGGG - Intronic
973656689 4:53055483-53055505 TTTGTAATGGGCCTGTTTTTAGG - Intronic
974566109 4:63579838-63579860 TTTGTTTATGGCCAGATTTTGGG - Intergenic
974974195 4:68869653-68869675 CTAGTTTATGGCCAGATTTTGGG + Intergenic
976045173 4:80938206-80938228 CCAGTATATGGCCAGATTTTGGG - Intronic
976977981 4:91186988-91187010 CTAGTTTATGGCCAGATTTTGGG + Intronic
977014951 4:91680460-91680482 CTTCTAACGGCACAGATTTTGGG - Intergenic
977039205 4:91993897-91993919 CTTGTATTGGTCCTGATTTTAGG - Intergenic
977270687 4:94914291-94914313 CTGATAAAGGACCAGATTTACGG + Intronic
978014835 4:103730350-103730372 TTTGTGAAGGGACAGACTTTTGG - Intergenic
978625907 4:110684860-110684882 ATTTTAAAGTGCCAGAATTTGGG - Intergenic
979769876 4:124509857-124509879 CTTGTATTGTGCCTGATTTTAGG - Intergenic
980160485 4:129156211-129156233 CTTGTAAAGTGACAGAATCTAGG + Intergenic
983635844 4:169897049-169897071 ATTGCAAAGGGCCAGCTTTATGG - Intergenic
987579846 5:19775562-19775584 CTTTTAAATGACCAGATTTCAGG + Intronic
987793719 5:22601766-22601788 CTTTCAAAGGGGTAGATTTTAGG + Intronic
989036928 5:37184014-37184036 CCTCTAATGGGTCAGATTTTAGG + Intronic
990109302 5:52304500-52304522 CCAGTATATGGCCAGATTTTGGG - Intergenic
991160572 5:63495207-63495229 CCTGGAAAGGGCCAGCTTTGGGG - Intergenic
991501821 5:67284395-67284417 TTTGTAAAGAGCCAGCTCTTGGG + Intergenic
994324883 5:98436846-98436868 CTTGCCCAGGGCCAGATTTCTGG - Intergenic
994419048 5:99509457-99509479 CTAGTTTATGGCCAGATTTTGGG + Intergenic
995825837 5:116298043-116298065 TCTATAAAGGGCCAGGTTTTAGG - Intronic
995879732 5:116830781-116830803 CTGGTAAATGGTCATATTTTTGG + Intergenic
996465232 5:123793758-123793780 CTAGAAAAGTCCCAGATTTTTGG - Intergenic
998572538 5:143275894-143275916 CAGGTAAAGAGCCAGACTTTGGG - Intergenic
999011482 5:148045913-148045935 TTTGTAAATGGACAAATTTTAGG - Intronic
1000470560 5:161634896-161634918 CTTGTAGACAGCCAGATTTCAGG - Intronic
1001597326 5:172906643-172906665 TTTGTAAATGGCCACATCTTAGG - Intronic
1001858830 5:175035524-175035546 CTTGCAAAGGGACAGATTTCGGG + Intergenic
1002596161 5:180324977-180324999 CTGGGAAAGGGCTAGATTTGGGG - Intronic
1002960133 6:1906634-1906656 CTTGTGAATGGCCAGCATTTTGG - Intronic
1004842666 6:19605249-19605271 CTTTCAAATGGCCAGATTCTAGG - Intergenic
1004854944 6:19739940-19739962 ATTGTGAAGAGCCAGGTTTTGGG - Intergenic
1008093223 6:47313157-47313179 CCAGTATATGGCCAGATTTTGGG + Intergenic
1009062369 6:58413160-58413182 CTAGTTTATGGCCAGATTTTTGG + Intergenic
1009423698 6:63491113-63491135 CTGGGAAAGGGCCAGATAGTTGG - Intergenic
1010096089 6:72048215-72048237 CTGGTTCAGGGCTAGATTTTTGG - Intronic
1010163738 6:72890829-72890851 CTTTACAAGGGCCAGATGTTTGG - Intronic
1011140621 6:84151662-84151684 CTGGTAGAAAGCCAGATTTTTGG + Intronic
1013034826 6:106371363-106371385 CTTGAAAAGGGCCAGTTCTTAGG - Intergenic
1013285157 6:108674873-108674895 TTTTTAAAGGCCCAGTTTTTAGG - Intronic
1013907556 6:115236636-115236658 CTTGTACAGGGCCTGCTTTAAGG + Intergenic
1014243220 6:119040785-119040807 CTTAAAAAGGGCCAGATTGAAGG - Intronic
1014539053 6:122651920-122651942 TTTGTAAAAGGCAAGGTTTTAGG - Intronic
1014863859 6:126504881-126504903 CCAGTATATGGCCAGATTTTGGG - Intergenic
1015581342 6:134728916-134728938 CTTGTAACTGGCCAAATCTTTGG - Intergenic
1016538025 6:145130670-145130692 CTTGTCATGTTCCAGATTTTAGG + Intergenic
1017091709 6:150764627-150764649 GTTGAAAAGGGCTAGATTTCAGG - Intronic
1017282655 6:152640292-152640314 CTTGTAAAGGGCCATCCCTTTGG - Intergenic
1019502896 7:1374043-1374065 CTTTTAAACAGCCAGATCTTGGG + Intergenic
1023080693 7:36523561-36523583 CTTGTAAAGGCACAGTTTTGGGG + Intronic
1023882533 7:44328398-44328420 CATGTCAAGGGCCAGATGATGGG - Intronic
1024728784 7:52231558-52231580 CTTGTAAAGAGAGAGATGTTTGG + Intergenic
1025756143 7:64344455-64344477 TTTGTAAAGGGCCAGACAATGGG - Intronic
1026328319 7:69330348-69330370 TTTGTTTATGGCCAGATTTTGGG - Intergenic
1027498116 7:78913323-78913345 CTTTTAAACAGCCAGATTTCAGG - Intronic
1028454006 7:91018681-91018703 CTTTTAAACAACCAGATTTTGGG - Intronic
1028872090 7:95781205-95781227 ACTGTAAAAGGCCAGATTTGGGG + Intronic
1028954092 7:96669279-96669301 CCTGTAAAGGGACAGATGATAGG + Intronic
1033479602 7:141726602-141726624 CTAGTACAGGGCCAGCATTTAGG - Intronic
1034615497 7:152412981-152413003 CTTGTAGAGGGGCTGGTTTTTGG - Intronic
1036052344 8:5213950-5213972 TTTGTAAAGATCCAGAATTTAGG + Intergenic
1037982461 8:23264013-23264035 CTCGTCAAGTGCCACATTTTGGG - Intergenic
1038058049 8:23880643-23880665 CTTGTAAACCACCAGATCTTGGG + Intergenic
1039167994 8:34708039-34708061 CTTATAAATAGCCAGATATTAGG + Intergenic
1039691572 8:39870401-39870423 CCAGTTAATGGCCAGATTTTGGG - Intergenic
1039692152 8:39875508-39875530 CCAGTTAATGGCCAGATTTTGGG - Intergenic
1041820840 8:62031141-62031163 CTTGAAAGGGGCCAAATTTGAGG - Intergenic
1041822728 8:62056960-62056982 CTTTTAAAGAACCAGATTTTGGG - Intergenic
1042397778 8:68311726-68311748 TCTGTAAAGGGCCAGATTTTAGG + Intronic
1044586686 8:93875115-93875137 TTTGTTTATGGCCAGATTTTGGG + Intronic
1044625363 8:94231391-94231413 CTTGTAGATGTCCATATTTTAGG + Intergenic
1045798640 8:106076518-106076540 TCTGTAAAGGACCAGATTATGGG + Intergenic
1047743303 8:127824712-127824734 GTTGTAAAGAGCAAGCTTTTAGG + Intergenic
1047863217 8:128991747-128991769 CTTAGAAAGGGCCTTATTTTTGG + Intergenic
1049460557 8:142725742-142725764 TTTGTTTATGGCCAGATTTTGGG - Intergenic
1053702084 9:40705061-40705083 TTTGTAAAGGGCCAGAAAATGGG - Intergenic
1054412144 9:64828521-64828543 TTTGTAAAGGGCCAGAAAATGGG - Intergenic
1055670336 9:78598850-78598872 TTTGTAAATGGCCACATCTTGGG - Intergenic
1056566782 9:87779757-87779779 TTTGTTTATGGCCAGATTTTGGG + Intergenic
1057338097 9:94173266-94173288 CTTATAAAGGGCCTGACGTTAGG + Intergenic
1059266278 9:113034431-113034453 CTTGCAAAGGGCATGACTTTAGG - Intergenic
1203617441 Un_KI270749v1:80502-80524 CATGTTAAGGTCCAGATATTTGG - Intergenic
1185950274 X:4424630-4424652 CTTGGAAAGGGGCAAAATTTAGG - Intergenic
1187682748 X:21784306-21784328 CCTGAAAAGGGCCAGAAATTTGG + Intergenic
1190484358 X:50910188-50910210 CTGGTAAAGAGCCAGATTTCTGG + Intergenic
1191949145 X:66569608-66569630 CCAGTTTAGGGCCAGATTTTTGG + Intergenic
1192005207 X:67204269-67204291 CTTGTAAAGGGTAAAATTCTAGG + Intergenic
1194225977 X:91258160-91258182 CTTGTAAAAGGCAAGCTTTTGGG + Intergenic
1194394752 X:93368691-93368713 CTTTTAAACAGCCAGATCTTGGG + Intergenic
1198249091 X:134861915-134861937 CTTGTTAAGGGACAGCTTGTGGG + Intergenic
1198845334 X:140904331-140904353 ATTGTCAGGGGCCAGATCTTAGG + Intergenic
1199333242 X:146586532-146586554 CTTTTAAACAGCCAGATCTTGGG - Intergenic
1202076811 Y:21044416-21044438 CTTGACAAGTGCCAGAGTTTTGG + Intergenic