ID: 1064157418

View in Genome Browser
Species Human (GRCh38)
Location 10:12915685-12915707
Sequence TGCTACTGGAGCCTTTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064157409_1064157418 21 Left 1064157409 10:12915641-12915663 CCAGAGATTCTGGGCAGGCTGTC 0: 2
1: 6
2: 18
3: 50
4: 246
Right 1064157418 10:12915685-12915707 TGCTACTGGAGCCTTTGGGTAGG No data
1064157407_1064157418 26 Left 1064157407 10:12915636-12915658 CCTGTCCAGAGATTCTGGGCAGG 0: 3
1: 12
2: 41
3: 62
4: 242
Right 1064157418 10:12915685-12915707 TGCTACTGGAGCCTTTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064157418 Original CRISPR TGCTACTGGAGCCTTTGGGT AGG Intronic
No off target data available for this crispr