ID: 1064157621

View in Genome Browser
Species Human (GRCh38)
Location 10:12916710-12916732
Sequence GCTCACATCTGATCTGGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064157611_1064157621 29 Left 1064157611 10:12916658-12916680 CCAACCTGGTACTATGGCGGGCT 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1064157621 10:12916710-12916732 GCTCACATCTGATCTGGAACCGG No data
1064157612_1064157621 25 Left 1064157612 10:12916662-12916684 CCTGGTACTATGGCGGGCTCAAA 0: 1
1: 0
2: 1
3: 5
4: 67
Right 1064157621 10:12916710-12916732 GCTCACATCTGATCTGGAACCGG No data
1064157615_1064157621 1 Left 1064157615 10:12916686-12916708 CCTGGAGCCAAGTGGACCAACCT No data
Right 1064157621 10:12916710-12916732 GCTCACATCTGATCTGGAACCGG No data
1064157617_1064157621 -6 Left 1064157617 10:12916693-12916715 CCAAGTGGACCAACCTGGCTCAC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1064157621 10:12916710-12916732 GCTCACATCTGATCTGGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064157621 Original CRISPR GCTCACATCTGATCTGGAAC CGG Intronic
No off target data available for this crispr