ID: 1064157873

View in Genome Browser
Species Human (GRCh38)
Location 10:12918702-12918724
Sequence GTGATTAAACAGATGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064157864_1064157873 3 Left 1064157864 10:12918676-12918698 CCCATCTACCCCATGTAACACTA 0: 1
1: 0
2: 0
3: 10
4: 216
Right 1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG No data
1064157865_1064157873 2 Left 1064157865 10:12918677-12918699 CCATCTACCCCATGTAACACTAT 0: 1
1: 0
2: 0
3: 14
4: 326
Right 1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG No data
1064157867_1064157873 -6 Left 1064157867 10:12918685-12918707 CCCATGTAACACTATGTGTGATT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG No data
1064157866_1064157873 -5 Left 1064157866 10:12918684-12918706 CCCCATGTAACACTATGTGTGAT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG No data
1064157868_1064157873 -7 Left 1064157868 10:12918686-12918708 CCATGTAACACTATGTGTGATTA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064157873 Original CRISPR GTGATTAAACAGATGGAAGG GGG Intronic
No off target data available for this crispr