ID: 1064158839

View in Genome Browser
Species Human (GRCh38)
Location 10:12925963-12925985
Sequence CCACAAAGGCAGAATTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064158834_1064158839 -3 Left 1064158834 10:12925943-12925965 CCCTGGGAGGCTTTATTGGGCCA 0: 1
1: 0
2: 2
3: 11
4: 121
Right 1064158839 10:12925963-12925985 CCACAAAGGCAGAATTTGTAGGG No data
1064158835_1064158839 -4 Left 1064158835 10:12925944-12925966 CCTGGGAGGCTTTATTGGGCCAC 0: 1
1: 0
2: 2
3: 11
4: 92
Right 1064158839 10:12925963-12925985 CCACAAAGGCAGAATTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064158839 Original CRISPR CCACAAAGGCAGAATTTGTA GGG Intronic
No off target data available for this crispr