ID: 1064164551

View in Genome Browser
Species Human (GRCh38)
Location 10:12974952-12974974
Sequence ATTCCTACCTCGCAGGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064164551_1064164558 28 Left 1064164551 10:12974952-12974974 CCTAACCCCTGCGAGGTAGGAAT 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1064164558 10:12975003-12975025 ATAAAGACTCAGAAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064164551 Original CRISPR ATTCCTACCTCGCAGGGGTT AGG (reversed) Intronic
900736144 1:4300636-4300658 ATTCCCACCTCTCAGGGCTATGG - Intergenic
903211569 1:21822102-21822124 ATTCCTGCCTCACAGGGTTGGGG + Intronic
903230970 1:21922176-21922198 ATTCCTACACTGCAGGGTTTTGG - Intronic
903302762 1:22390855-22390877 TTTTCTACCTCGGAGAGGTTGGG - Intergenic
905856756 1:41319644-41319666 ATTCCTGCCTCACAGGGATCTGG - Intergenic
906279062 1:44541046-44541068 ATACCTACCTCTCAGTTGTTGGG - Intronic
906693058 1:47805448-47805470 CTCCCTACCTCGGTGGGGTTTGG + Intronic
907386824 1:54131194-54131216 ATTCCTACCTGCAAGGCGTTTGG - Intergenic
908324049 1:63006085-63006107 ATGCCTACCTTGCAGTGTTTTGG - Intergenic
911370894 1:96993557-96993579 ATTCCTTCCTCTCAGGTGTGGGG - Intergenic
915514352 1:156404090-156404112 ACTCCTACCTGGTAGGGGGTGGG - Intergenic
920109977 1:203580951-203580973 AGTCCTACCTGGCAGGGGTGGGG - Intergenic
921497633 1:215860367-215860389 ATTCTTAGCTTGCAGGGGGTGGG - Intronic
922213994 1:223506321-223506343 CTTCCTACCTCCCAGGGCCTGGG + Intergenic
1064164551 10:12974952-12974974 ATTCCTACCTCGCAGGGGTTAGG - Intronic
1066132302 10:32406164-32406186 ATTCCTACCTGTCAGGGGAGGGG - Intergenic
1068726830 10:60312463-60312485 GTTCCTACCTTAAAGGGGTTTGG + Intronic
1078451286 11:11442827-11442849 GTCCCTCCCTCCCAGGGGTTAGG - Intronic
1079320448 11:19447512-19447534 ATTCCCACCTCACAGAGGTTTGG + Intronic
1080586359 11:33686330-33686352 ATTGCTAGCTGGCAGGGCTTGGG + Intergenic
1082081740 11:48017550-48017572 AGTGCTACCTAGCAGGGGTGAGG - Intronic
1082897033 11:58203065-58203087 ATTCCAACCTCTAAGGGGATTGG - Intergenic
1083334391 11:61914268-61914290 ACTCCAACCTCCCAGGGGTTGGG - Intronic
1083666574 11:64278522-64278544 AGTCCCACCTCGCAGGGCTGTGG - Intronic
1084444276 11:69194419-69194441 AGTCCTACCTCACAGGGCTGGGG + Intergenic
1085295955 11:75431747-75431769 ATCCCTACCTCACAGGGCTGTGG + Intergenic
1086574773 11:88327236-88327258 ATTCCTACCTGGCAGATGTGTGG + Intronic
1089365705 11:117919717-117919739 ATACCAACCTCCCAGGGGTGTGG - Intronic
1092873281 12:12826218-12826240 ATACCTATCTAGCAGGGTTTTGG + Intronic
1101544752 12:105701992-105702014 AGACCTACCTCGCAGAGTTTTGG + Intergenic
1104916172 12:132265762-132265784 ATTCCTGCCTCGGAGGGGCCAGG + Intronic
1106284709 13:28308610-28308632 ATTCCTACCACGCAGGGACTTGG + Intronic
1109718854 13:66251744-66251766 ATTCCTAAATCCCAGGGATTAGG + Intergenic
1110133368 13:72035184-72035206 ATCCCTCCCTCTCAGGGCTTTGG + Intergenic
1113432647 13:110264107-110264129 ATTCCTGGCTGGGAGGGGTTGGG - Intronic
1117362008 14:54984736-54984758 AATCCTACCTTGCATGGATTGGG - Exonic
1117476356 14:56098966-56098988 ATACCTACCTCACAGGGTTACGG - Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119478995 14:74948216-74948238 CTCCCAGCCTCGCAGGGGTTCGG - Intronic
1122893473 14:104743760-104743782 ATACCCACCTAGCAGGGGTCTGG - Intronic
1125297048 15:38214778-38214800 ATTCCTACCTTGTAGGTGTGAGG + Intergenic
1125624284 15:41093727-41093749 AGTCCTACTTCACAGGGGTGAGG + Intronic
1130563158 15:84974488-84974510 ATGCCAACCTGGCAGGGGTTTGG + Intergenic
1130747673 15:86673573-86673595 ATCTCTACCTCACAGGGCTTTGG + Intronic
1130896117 15:88171642-88171664 ATTCCTACCCTGCAGGGCTTTGG - Intronic
1134409645 16:13993351-13993373 GTCCCTACCTCATAGGGGTTTGG + Intergenic
1134465674 16:14475031-14475053 TTTCCTACCTAGCAGGAATTCGG + Intronic
1135108754 16:19673766-19673788 ATTCCTACCTTGGGGGGCTTGGG - Intronic
1135245087 16:20849121-20849143 ATTACTATCTCACAGGGATTTGG - Intronic
1135419863 16:22298268-22298290 ATTCCTACCTCATAGGGTTGTGG + Intronic
1135419884 16:22298438-22298460 ACTCCTTCCCCGCAGGGGTCTGG + Intronic
1137607923 16:49799190-49799212 ATACCAACCTCGCAGGAGGTTGG + Intronic
1137875999 16:51997370-51997392 CTTCCTACCTCACAGGGTTGAGG + Intergenic
1141486384 16:84343097-84343119 ATTCCCACCTCTCAGGGGTGTGG - Intergenic
1146401210 17:32501426-32501448 ATTCCTTCCTCCAAGGTGTTGGG - Intronic
1146500121 17:33356912-33356934 CTTCCTTCCTCCCAGAGGTTGGG - Intronic
1147334209 17:39716952-39716974 ATACCTACCTTGCTGGGGTGTGG + Intronic
1148958899 17:51376641-51376663 ATTCCTACCTCGTAGGGTGGCGG + Intergenic
1149033859 17:52113220-52113242 ATTCCTACCTTACAGAGGCTGGG - Intronic
1155552374 18:26978736-26978758 CTTCCTACCTCACAGGGCTGTGG + Intronic
1159845768 18:73458097-73458119 ATACCTACCACGTAGGAGTTTGG - Intergenic
1167477924 19:49711696-49711718 ATTCCCACCTTGCAGGGATGTGG + Intronic
1167816385 19:51885139-51885161 ATTCTAACCTTTCAGGGGTTGGG + Intronic
1168188678 19:54721365-54721387 ATTCATACATACCAGGGGTTAGG - Intergenic
926629003 2:15119859-15119881 ATTCCTACTTTGCAGAGGTGTGG - Intergenic
931474082 2:62570532-62570554 ACTCATACCTCGCAGGGAGTGGG + Intergenic
933040476 2:77458670-77458692 TTTCCTTCCTTGCAGAGGTTCGG + Intronic
933244863 2:79963823-79963845 AGGTCTACCTGGCAGGGGTTTGG - Intronic
934077895 2:88443343-88443365 ATTCATGCCTCCCAGGGTTTTGG + Intergenic
938415989 2:131104106-131104128 GTTCCAGCCTAGCAGGGGTTGGG - Intergenic
940323464 2:152400921-152400943 ATTCCTCCCTGGCTGTGGTTTGG - Intronic
947004504 2:225495279-225495301 ATTTGTACTTCTCAGGGGTTAGG + Intronic
947618779 2:231575568-231575590 ATTCATACATCCCAGGAGTTTGG + Intergenic
1173333242 20:42093036-42093058 ATTCATAGGTCTCAGGGGTTAGG + Intronic
1175206311 20:57314426-57314448 ATTCCTACCTCATAGGGTTGAGG - Intergenic
1177502893 21:21982105-21982127 ATTCCTACCCCACATGGTTTGGG + Intergenic
1178164394 21:29956398-29956420 ATTCTTACCTGGCAGGGTTTTGG - Intergenic
1183505797 22:38208225-38208247 ATACCTGCCTCGCAGGGTTTTGG - Intronic
1183531110 22:38353836-38353858 ATCCCTCCCTTGCAGGAGTTTGG + Intronic
1184118125 22:42433719-42433741 TTTCCTACCGCGCAGGGGGCAGG + Intergenic
1184612015 22:45610292-45610314 ATTACTACCTTGCAGGAGTTTGG + Intergenic
949210776 3:1498070-1498092 ATGACTACTTCTCAGGGGTTAGG + Intergenic
949941769 3:9160130-9160152 ATACCTACCTCACAGGGTTATGG + Intronic
952848453 3:37708488-37708510 ATACCTACCGCTCAGAGGTTGGG - Intronic
954533102 3:51337772-51337794 ATTCATACCTAGCAGGGTCTGGG - Intronic
955044133 3:55343885-55343907 ATTCCTCCCTCCCAGGGTTCAGG - Intergenic
962308868 3:134312115-134312137 TTTCCTACCTGGCAGGGGTGTGG - Intergenic
967873063 3:194248300-194248322 ATGCCGAGCTCCCAGGGGTTAGG + Intergenic
968360724 3:198144963-198144985 ATTCCCACCTCACAGGGGCAGGG - Intergenic
971381252 4:26100174-26100196 TCTCCTACCTCTCAGGGCTTTGG + Intergenic
972572302 4:40321488-40321510 AATACTACCTTGTAGGGGTTTGG + Intergenic
976475433 4:85477276-85477298 ATTACTTCATCTCAGGGGTTTGG + Intronic
983212986 4:164977579-164977601 AGTCCTTCCTCGCGGGGGCTCGG - Exonic
988124475 5:27011250-27011272 ATTCCTAGGTTCCAGGGGTTGGG - Intronic
997835798 5:137192436-137192458 ATTCCCACCTAGCAGTGGCTGGG - Intronic
1001870347 5:175148911-175148933 ATTCCTCCCTCGCTGGGTGTGGG + Intergenic
1003871046 6:10403767-10403789 ACTCAAACCTCGCAGGGGTGAGG + Intronic
1005910673 6:30306785-30306807 ATTCCTTCCTTCCAGGGGGTGGG + Intergenic
1006020248 6:31113539-31113561 ATTCCTACGTTCCAGGGATTAGG + Intergenic
1012047279 6:94293867-94293889 ATCTCTACCTTGCAGGGGTTTGG - Intergenic
1016060489 6:139625097-139625119 TTTCCTGCCTCCCAAGGGTTAGG - Intergenic
1019259281 7:71669-71691 ATTCCCACCTCACAGGGGCAGGG + Intergenic
1020338384 7:7082790-7082812 ATTCTAACCTCACAGGGCTTGGG + Intergenic
1021704052 7:23349571-23349593 ATTCCTTTCTCTCAGGGGATCGG - Intronic
1042673351 8:71288152-71288174 AGTCATACCTGGCTGGGGTTGGG - Intronic
1043552299 8:81387856-81387878 ATCCCTACCTCATAGGGTTTGGG - Intergenic
1050627113 9:7516780-7516802 ATTCCTACCTCACAGGGTGGTGG + Intergenic
1058892235 9:109371035-109371057 CTTCCTTCCTCTCAGGGGTGTGG - Intergenic
1060403336 9:123360939-123360961 ATTCCTTCCTCCCATGGGGTTGG + Intronic
1060877788 9:127095733-127095755 ATTCCTTCCTGGCTGGTGTTTGG + Intronic
1062745427 9:138208794-138208816 ATTCCCACCTCACAGGGGCAGGG - Intergenic
1189503738 X:41590050-41590072 ATTCCTTCCTAGAAGGAGTTGGG - Intronic
1189695410 X:43656542-43656564 ACTCCTACCTCGCAGGATATGGG - Intronic