ID: 1064166850

View in Genome Browser
Species Human (GRCh38)
Location 10:12994055-12994077
Sequence TTCAGCTTGGACAGTGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064166850_1064166858 27 Left 1064166850 10:12994055-12994077 CCAGATCCACTGTCCAAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1064166858 10:12994105-12994127 CAGCATCTAGAGGTGGGGCATGG No data
1064166850_1064166859 30 Left 1064166850 10:12994055-12994077 CCAGATCCACTGTCCAAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1064166859 10:12994108-12994130 CATCTAGAGGTGGGGCATGGTGG No data
1064166850_1064166854 17 Left 1064166850 10:12994055-12994077 CCAGATCCACTGTCCAAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1064166854 10:12994095-12994117 GCAGCATCAACAGCATCTAGAGG No data
1064166850_1064166856 21 Left 1064166850 10:12994055-12994077 CCAGATCCACTGTCCAAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1064166856 10:12994099-12994121 CATCAACAGCATCTAGAGGTGGG No data
1064166850_1064166855 20 Left 1064166850 10:12994055-12994077 CCAGATCCACTGTCCAAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1064166855 10:12994098-12994120 GCATCAACAGCATCTAGAGGTGG No data
1064166850_1064166857 22 Left 1064166850 10:12994055-12994077 CCAGATCCACTGTCCAAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1064166857 10:12994100-12994122 ATCAACAGCATCTAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064166850 Original CRISPR TTCAGCTTGGACAGTGGATC TGG (reversed) Intronic
900604823 1:3519245-3519267 GTCACCTTGGCCAGTGGGTCTGG - Intronic
905405796 1:37731617-37731639 TTCTCCTAGAACAGTGGATCTGG - Intronic
908539809 1:65111727-65111749 TACAGCTTGGGCCGTGGCTCTGG - Intergenic
908842597 1:68294530-68294552 TTCATCTTGGACAGTCGGTCTGG - Intergenic
909148140 1:71964452-71964474 CTCAGCTAGGACTGTGGATTAGG - Intronic
912863311 1:113234446-113234468 AAGAGCTTAGACAGTGGATCAGG - Intergenic
915454200 1:156028538-156028560 TCCAGCCTGGACAATGGAGCAGG + Intergenic
919827680 1:201515165-201515187 CTCAGCTTGGACACAGCATCTGG - Intergenic
920349765 1:205330002-205330024 TGCAGCATGGACAGTGGGACAGG - Intergenic
923860332 1:237886458-237886480 TACAGCATGGACAGTGGAGAAGG + Intronic
924482685 1:244451526-244451548 CTCATTTTGGCCAGTGGATCCGG + Intronic
1063105797 10:2991012-2991034 TTCAGTGTGGAGAGTGGAGCTGG - Intergenic
1064166850 10:12994055-12994077 TTCAGCTTGGACAGTGGATCTGG - Intronic
1065775347 10:29114594-29114616 TTCAGCCTTTACAGAGGATCTGG - Intergenic
1067941624 10:50661456-50661478 TTCAGCTTGGCCTGTCCATCAGG + Intergenic
1070458335 10:76640418-76640440 GTCAACTTGTACAGTGGATCTGG + Intergenic
1070635631 10:78125025-78125047 TTCAGCTTTGACAGTGAGTAAGG - Intergenic
1070862861 10:79686415-79686437 TTCAGCTTGGCCTGTCCATCAGG + Intergenic
1075402194 10:122169015-122169037 TTCAGGTTGGACAGGGGTTTAGG + Intronic
1075527208 10:123197029-123197051 TCCAGCCTGGACAGAGGATGAGG + Intergenic
1078048184 11:7937419-7937441 TTAAGCTTGGAAACTGGCTCAGG - Intergenic
1078528987 11:12121778-12121800 TTCAGCTTTGACATTTGAGCGGG + Intronic
1079142141 11:17818664-17818686 TGCAGCTTGGAGAGTAGAGCTGG - Intronic
1081289873 11:41311206-41311228 TTCATTTTGGACAGTAGTTCTGG + Intronic
1082798596 11:57396624-57396646 TTTAGCTTGGCCAGTGGAGCTGG - Intronic
1083912176 11:65716603-65716625 TTGAGCCTGGCCAGTGGTTCAGG - Intronic
1090719767 11:129460487-129460509 TGCAGCTTGGACAGAGGACTTGG - Intergenic
1093565142 12:20593583-20593605 ATCAAATTGGTCAGTGGATCTGG - Intronic
1102893237 12:116578365-116578387 TCCAGCCTGGACAATGGAGCAGG - Intergenic
1103694267 12:122801553-122801575 TTGAACTTGGACAGTTGGTCAGG - Exonic
1105476700 13:20734254-20734276 TTCAGGTAGGACAGTGGTCCAGG + Intronic
1112210579 13:97373323-97373345 TTCAGGTTGGAGAATGGATGTGG + Intronic
1113509686 13:110843237-110843259 TGGAGCCTGGACAGTGGAACTGG - Intergenic
1120229934 14:81830939-81830961 TTCAGTTTTGACAGTGAATATGG + Intergenic
1122540226 14:102493830-102493852 TTCTGCGTGGAAAGTGGCTCGGG + Intronic
1122633414 14:103118568-103118590 TCCAGCAAGGACAGTGGGTCAGG + Intergenic
1125725207 15:41864748-41864770 TGCTGCTTGGACACTGGATGGGG + Intronic
1127758250 15:62113530-62113552 TTCAGCTTGGTCCGTGTCTCTGG + Intergenic
1130560555 15:84955091-84955113 CTCAGCTGGGACAGTTGACCTGG - Intergenic
1140253286 16:73313773-73313795 GTCAGCTTGGAGAGTGGTTTTGG + Intergenic
1145947163 17:28785164-28785186 TAAAGCTGGGTCAGTGGATCTGG + Intronic
1145960222 17:28882847-28882869 TTCAGCCTGGACTGTGCAGCAGG - Intronic
1147720713 17:42537651-42537673 TTCAGCGTGCACAGTGGCTTGGG + Intronic
1150806520 17:68323762-68323784 TTGATCTTTGACAGTGGGTCTGG - Intronic
1150850760 17:68701736-68701758 CACAGCTTGGAGTGTGGATCTGG - Intergenic
1150913945 17:69417067-69417089 TTCTGCTTGGAAAGTACATCTGG + Intronic
1152395815 17:80032338-80032360 TTCCGACTGGACAGTGGATTTGG + Intronic
1152944572 17:83192011-83192033 TTCAAATTGGAAAGTGGAACAGG + Intergenic
1154267019 18:12887622-12887644 TTGAGCTTGGACACAGGATAAGG + Intronic
1154290655 18:13103113-13103135 TCCAGCTTGGACAGTGGCAAAGG - Intronic
1157233240 18:45939016-45939038 CTCAACTTGGCCAGTGGCTCAGG + Intronic
1159508066 18:69361029-69361051 TACAGCTTGCACTGTGGACCTGG + Intergenic
1163095493 19:15054274-15054296 TTCAGCTGGGGCTTTGGATCTGG - Intronic
1164438257 19:28251123-28251145 TGCAGCCTGGACAGAGGTTCTGG - Intergenic
1165920721 19:39296427-39296449 TGCAGCTTGGACCGTGGTGCTGG + Exonic
1166175765 19:41068479-41068501 TTCTGCTGCGACAGTGGAGCTGG + Intergenic
1166366882 19:42282293-42282315 TTCAGCTCTGTCAGTGGATGAGG + Intronic
1167832844 19:52040544-52040566 TCCAACTTGGAGAGTGCATCTGG + Exonic
928076903 2:28273359-28273381 TTCAGATTGAACAGTGGAACAGG - Intronic
929261955 2:39875819-39875841 TTGAGCTTGGTCAGTGGTTGAGG + Intergenic
930730957 2:54726992-54727014 TTCAGCTTCAACAGTGCATTTGG - Intronic
932139594 2:69263803-69263825 ATCACCTTGGATAGTGGATCTGG - Intergenic
935385207 2:102492306-102492328 TTCAGCTAGGACAGTGCAGAAGG - Intronic
937669138 2:124519970-124519992 TTCAGCTTAAACAGTTTATCAGG + Intronic
940715670 2:157220619-157220641 TTCAGTTTTGCCAGTGAATCTGG + Intergenic
942097690 2:172548870-172548892 TTCGGCTGGGGCAGTGGCTCAGG + Intergenic
945008026 2:205430391-205430413 ATCATATTGGACAGTGCATCTGG - Intronic
945484804 2:210382346-210382368 TACAGCTTGCACAGTGCACCTGG + Intergenic
945564027 2:211373909-211373931 TGAAGCTTTGACATTGGATCAGG + Intergenic
946450875 2:219778058-219778080 TTCAGCCAGGACATTGTATCAGG + Intergenic
946554862 2:220844830-220844852 TTCAGCTAGGACTGGGGATTTGG - Intergenic
947349730 2:229231070-229231092 TTCAGCTGGGACACTGGCTGGGG - Intronic
948455416 2:238102364-238102386 TTCAGCTTGGAGAGTGGCTGGGG + Intronic
1169621634 20:7513548-7513570 TTCAACTTGGACAATGAATCTGG - Intergenic
1172912551 20:38420773-38420795 TGCAGATTGAACAGTGGATCCGG + Intergenic
1173293873 20:41738633-41738655 TAAAGGTTGGGCAGTGGATCAGG + Intergenic
1175142702 20:56872747-56872769 CTGAGCTTGGACAGTGCATCTGG - Intergenic
1177486945 21:21770525-21770547 TTCAGCTTGATCAATGGATCTGG - Intergenic
1178638183 21:34323363-34323385 ATCACCTTGGAAAGGGGATCGGG - Intergenic
1179257509 21:39729490-39729512 TTTGCCTTTGACAGTGGATCAGG + Intergenic
1179318650 21:40269442-40269464 TTCTGCTTAGGCAGGGGATCTGG + Intronic
1181582353 22:23835252-23835274 TTCAGAATGGACACAGGATCTGG + Intronic
1182347584 22:29677543-29677565 TTGGGCTTGGACAATGGAACCGG - Intronic
1183864869 22:40696029-40696051 ATCAGCTGGGACATTGGATTTGG - Intergenic
1184696407 22:46141600-46141622 TTCAGCCGTGAAAGTGGATCAGG - Intergenic
1184915333 22:47564973-47564995 TCCAGCTTGGACAGGGCATGTGG - Intergenic
949127278 3:461207-461229 TTCAACTTGGACTGAGGACCAGG + Intergenic
950143254 3:10629677-10629699 TGAAGCTTGGGCAGTGGAGCTGG - Intronic
950850535 3:16058031-16058053 TTCAGATTGGATAGTTGATTAGG - Intergenic
951819419 3:26791528-26791550 TTCTGCTTGGAGAGTGGAGAGGG - Intergenic
952553200 3:34502283-34502305 TTCAGAGTGGAGAGTGGGTCAGG + Intergenic
952933799 3:38379766-38379788 TTCAGCTTGGACAGGGAAGAGGG + Intronic
955655791 3:61243473-61243495 TTCTGCTTTGACAGAGGATGGGG + Intronic
955760092 3:62270976-62270998 TCCAGCCTGGACAGTGGAGAAGG + Intronic
955799333 3:62669597-62669619 TTGAACTTGGACAGTGGAGTGGG - Intronic
956016240 3:64886206-64886228 TTTAGCTTGGACTGTACATCAGG - Intergenic
962238807 3:133732882-133732904 TTCAGGTTGGACAGTGAATTAGG - Intergenic
963457509 3:145564322-145564344 TTAATCTTGGTCAGTGGCTCTGG + Intergenic
964875536 3:161364215-161364237 TTCTGCCTGGATAGTTGATCAGG + Intronic
970046337 4:11858948-11858970 AACAGCTTGGACAGTGCACCTGG + Intergenic
973991303 4:56410510-56410532 TTCAACATGGAGAGTGGAGCAGG + Intronic
975637124 4:76461853-76461875 TTCATCTTGGACAGTGAATATGG - Intronic
975688925 4:76947076-76947098 AGCAGGTTGGAGAGTGGATCTGG + Intergenic
977046172 4:92071375-92071397 AACAGCTTGCACAGTGCATCTGG - Intergenic
977130520 4:93230268-93230290 TTAAGTTTGGAAAGTTGATCAGG - Intronic
979426366 4:120572338-120572360 TTCAGCTTGCACTGTGCATCTGG - Intergenic
981820932 4:148886702-148886724 TTCACATTGGACAGGGAATCTGG + Intergenic
983766369 4:171489545-171489567 CTCTGCTAGGACAGTGGATTTGG + Intergenic
985183984 4:187296346-187296368 CTCTGCTAGGACAGTGGATAAGG - Intergenic
985237263 4:187889580-187889602 TTCAGCTATGACAGAGGCTCAGG + Intergenic
986198469 5:5559584-5559606 TTCTGCTTGGAAAGTTGGTCTGG + Intergenic
986788378 5:11136904-11136926 TTTAGCCTGGTCAGGGGATCAGG - Intronic
987161095 5:15143739-15143761 TTCTGGTTGGTCAGTGGATGAGG + Intergenic
989165247 5:38427215-38427237 TTCCGCTTTGACTGTGGCTCTGG + Exonic
991956505 5:72000225-72000247 TTTAGCATGGACAGTGGAGAAGG + Intergenic
993238348 5:85345158-85345180 TTCAGCCTGGACAATGGAGCAGG + Intergenic
1000661545 5:163945506-163945528 TACAGCTTACACAGTGGAACAGG - Intergenic
1006476809 6:34260897-34260919 TACAGCTTGCACCGTGGACCTGG - Intergenic
1007716674 6:43860153-43860175 TGCAGCGTGGAGAGTGGATTAGG + Intergenic
1009595295 6:65728001-65728023 TTCAGCTTGAAGAGGGGATAAGG - Intergenic
1013361097 6:109394539-109394561 TTGGGCTTGGACAGTGGCTGAGG + Intronic
1016732976 6:147446522-147446544 TTCAGTTTGGATTCTGGATCAGG + Intergenic
1020714067 7:11647888-11647910 TTCAGATTGGCCATTGTATCAGG - Intronic
1020869346 7:13607900-13607922 TACAGCTTGCACAGTGCACCTGG + Intergenic
1022197123 7:28079832-28079854 TTCAGCTAGCACCATGGATCAGG + Intronic
1023842805 7:44106532-44106554 TGCATCTTGGACAGTGCCTCCGG + Exonic
1025723335 7:64036154-64036176 TTCAGCCAGGGCAGTGGCTCAGG - Intronic
1025900571 7:65741096-65741118 TTCAGCTTGGGCAATGGAGTGGG + Intergenic
1026122987 7:67553656-67553678 CTCAGCCTGGACTGTGGACCAGG - Intergenic
1029623761 7:101706924-101706946 GGCAGCTTGGACATTGGATACGG - Intergenic
1030837726 7:114310156-114310178 TTCAGCTTAGCCAGAGTATCAGG + Intronic
1032309334 7:130768576-130768598 TTCAGTTTAGCCAGTGGAGCTGG - Intergenic
1033341001 7:140492217-140492239 TTCAGCTAAGACAGTGGAAGAGG - Intergenic
1033865471 7:145686227-145686249 TTCAGAGTGGACAGTGGAAAAGG + Intergenic
1033919230 7:146368122-146368144 GTCAGCAAGGACAGAGGATCAGG - Intronic
1034530196 7:151690919-151690941 TTGAGCTGGGACAGTGCACCAGG - Intronic
1036800503 8:11787474-11787496 TTCAGCTGGGGCAGAGGAGCAGG - Intergenic
1038817448 8:30919686-30919708 TCCAGCCTGGACAATGGAACGGG - Intergenic
1039230728 8:35444690-35444712 TTCAGGGTGGACAGTGGACCAGG - Intronic
1040998144 8:53422326-53422348 GTGAGCTTGGACAATGGATAAGG + Intergenic
1041574160 8:59374250-59374272 TTCAGCTTGGAAAATGTATGAGG - Intergenic
1055905925 9:81293038-81293060 TTCAGCTTCTCCAGTGGAGCGGG + Intergenic
1056125498 9:83532850-83532872 CTCTTCTTGGACAGTGGATGTGG + Intronic
1056891191 9:90494521-90494543 TGCAGCCTGCACAGTGGATTTGG + Intergenic
1057893168 9:98884916-98884938 TTCAGCGTGGAAAATGGATGGGG - Intergenic
1058229941 9:102413257-102413279 TTCAGCTTTGACACTTGAACTGG - Intergenic
1060713681 9:125898414-125898436 TTCAGCCTGGGCAGTGTAGCAGG + Intronic
1062206603 9:135341114-135341136 CGCAGCTTGGACTGTGGATTTGG - Intergenic
1186790548 X:12993492-12993514 TTAACCTTGGGCAGTGGATTTGG + Intergenic
1192547658 X:72027260-72027282 TCCAGCTTGGAGTCTGGATCAGG + Intergenic
1193332703 X:80253341-80253363 TTCAGGTAGGAGAGTGAATCTGG - Intergenic
1193503516 X:82309973-82309995 TACAGCTTGCACTGTGCATCTGG - Intergenic
1193948152 X:87764041-87764063 TACAGCTTGCACTGTGCATCTGG - Intergenic
1194043294 X:88970355-88970377 TACAGCTTGCACTGTGCATCTGG - Intergenic
1199330632 X:146554104-146554126 TTCCACTTGGGCATTGGATCTGG - Intergenic
1202585011 Y:26414065-26414087 TTCTGGTTGGACAGTGGCACAGG - Intergenic