ID: 1064166852

View in Genome Browser
Species Human (GRCh38)
Location 10:12994061-12994083
Sequence TTTCCATTCAGCTTGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064166852_1064166856 15 Left 1064166852 10:12994061-12994083 CCACTGTCCAAGCTGAATGGAAA 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1064166856 10:12994099-12994121 CATCAACAGCATCTAGAGGTGGG No data
1064166852_1064166857 16 Left 1064166852 10:12994061-12994083 CCACTGTCCAAGCTGAATGGAAA 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1064166857 10:12994100-12994122 ATCAACAGCATCTAGAGGTGGGG No data
1064166852_1064166858 21 Left 1064166852 10:12994061-12994083 CCACTGTCCAAGCTGAATGGAAA 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1064166858 10:12994105-12994127 CAGCATCTAGAGGTGGGGCATGG No data
1064166852_1064166859 24 Left 1064166852 10:12994061-12994083 CCACTGTCCAAGCTGAATGGAAA 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1064166859 10:12994108-12994130 CATCTAGAGGTGGGGCATGGTGG No data
1064166852_1064166854 11 Left 1064166852 10:12994061-12994083 CCACTGTCCAAGCTGAATGGAAA 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1064166854 10:12994095-12994117 GCAGCATCAACAGCATCTAGAGG No data
1064166852_1064166855 14 Left 1064166852 10:12994061-12994083 CCACTGTCCAAGCTGAATGGAAA 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1064166855 10:12994098-12994120 GCATCAACAGCATCTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064166852 Original CRISPR TTTCCATTCAGCTTGGACAG TGG (reversed) Intronic
900333530 1:2149190-2149212 TCTCCATTCAGGTGGTACAGTGG + Intronic
900588635 1:3447711-3447733 TTTCCTTTCAGCCTGGTCAGTGG + Intergenic
900643755 1:3699459-3699481 TCTCCCTCCAGCCTGGACAGGGG - Intronic
900850134 1:5136252-5136274 TTCCCATTCAATTTGGAAAGGGG + Intergenic
908780330 1:67685112-67685134 TTTGCATGCAGCTTGGCCATTGG - Exonic
910163453 1:84298617-84298639 TTTCCTTTCATCCTGGAGAGAGG - Intronic
911102335 1:94104585-94104607 TGTCCATGCAGCTGGGGCAGGGG + Intronic
915638745 1:157204818-157204840 TGACCATTCAGCTGGGTCAGAGG + Intergenic
920686958 1:208116853-208116875 ATTCCATTCATCTGGGTCAGGGG - Intronic
922535866 1:226380162-226380184 TTTCCTTTCAATTTGAACAGAGG - Exonic
1063269086 10:4486848-4486870 TTTCCATCAGGCTTGGCCAGAGG - Intergenic
1064166852 10:12994061-12994083 TTTCCATTCAGCTTGGACAGTGG - Intronic
1065149724 10:22810638-22810660 TTTCCACTCATAGTGGACAGTGG + Intergenic
1065498174 10:26351184-26351206 ATTCCAATCAGCTTGGACAAGGG + Intergenic
1066588920 10:36970879-36970901 TATCTATTCAGCATGGCCAGAGG + Intergenic
1069969545 10:72154381-72154403 TTAATATTCAGCTTGGTCAGTGG - Intronic
1072830276 10:98650190-98650212 TTTCCATTCAGCTGGCAATGGGG - Intronic
1076662330 10:132064050-132064072 TTTCTGTTAAGCTTGGACTGGGG + Intergenic
1078969121 11:16386180-16386202 TTTGCATTTAGCTTGGAAAGTGG + Intronic
1079107902 11:17585401-17585423 TTATCATTCAGTTTAGACAGGGG + Intronic
1080282950 11:30579783-30579805 TTTACATTCAGCTGGGAAATAGG - Intronic
1080685849 11:34514050-34514072 TTCCCCTCCAGCTTGCACAGAGG - Intergenic
1081294714 11:41371379-41371401 TTTCTATTAAGTTTGGACATTGG - Intronic
1082671937 11:56044855-56044877 TTTCCATTCAGCTTAATCACAGG - Intergenic
1083151970 11:60797643-60797665 TTTCCAATCAGCTTTGAGATTGG - Intronic
1084788274 11:71456731-71456753 TTTGCATCCAGCAGGGACAGGGG + Intronic
1085899157 11:80677056-80677078 TATCTATTCAGCATGGCCAGAGG - Intergenic
1086257997 11:84902830-84902852 CATACATTCAGCTTGGATAGCGG - Intronic
1086587583 11:88473181-88473203 TTTCCATTTAGTATGGACTGAGG + Intergenic
1087324843 11:96709181-96709203 TTTGTCTTCAGCTTGGACAGAGG + Intergenic
1088373249 11:109114123-109114145 TTTCCTGTCAACCTGGACAGAGG - Intergenic
1089081062 11:115776647-115776669 TTTGCTTTCAGTTTGGACAGAGG + Intergenic
1089152262 11:116373213-116373235 TATCGATTTAGCTTTGACAGTGG - Intergenic
1090308546 11:125713612-125713634 TGTCCATTCAGTATGGACTGTGG + Intergenic
1090460251 11:126885051-126885073 CTTGGATTCAGATTGGACAGTGG + Intronic
1092896477 12:13016083-13016105 TCTCCATTCAGCTTGGACTTGGG + Intergenic
1093355268 12:18159293-18159315 TTTGCAAACAGCTAGGACAGCGG + Intronic
1093359637 12:18207647-18207669 TTTCCAATCAGTTTGGAAAAAGG + Intronic
1093845811 12:23969995-23970017 TTCCCATTTAGCTGGGGCAGGGG - Intergenic
1097887767 12:64747031-64747053 TTTCCTTTAAGCTTGGACTTTGG + Intronic
1099049270 12:77763582-77763604 TGTTCATTCAGGTTGGACAGAGG - Intergenic
1102203469 12:111074544-111074566 GTGGCCTTCAGCTTGGACAGGGG + Intronic
1104359521 12:128118707-128118729 TTTCCTTTCAGCTTCGTGAGAGG + Intergenic
1107072174 13:36282577-36282599 TTTCCTTTCTGCTTGGTCTGTGG + Intronic
1107262306 13:38508327-38508349 TTTCTAGTCAGCCTGGATAGAGG + Intergenic
1107575115 13:41710286-41710308 TTTCTATTCAGCTGGGAGACAGG + Intronic
1110866320 13:80399815-80399837 TTTGCATTCAGCTCGTACTGGGG - Intergenic
1112992010 13:105525432-105525454 TTTCCATTCTGCTGGGAGAAGGG + Intergenic
1113073534 13:106446111-106446133 TGTCCCTTCAGCTGGGCCAGAGG - Intergenic
1113472290 13:110555613-110555635 TTTCCTCGCAGCTTGGGCAGAGG + Intronic
1117773719 14:59160815-59160837 TTTCCATGCATCATGGAGAGAGG + Intergenic
1119091705 14:71788487-71788509 TATCCATTCAAGTTTGACAGAGG - Intergenic
1119991105 14:79198664-79198686 ATTCCATTCAACTAGGTCAGTGG + Intronic
1120816610 14:88866506-88866528 TTTCCTTTCAGCCTACACAGTGG + Intronic
1125402634 15:39320497-39320519 CTTCCATTCACCATGGAAAGTGG - Intergenic
1126226568 15:46277486-46277508 TTTCAATTCAGATTGGAAAATGG + Intergenic
1129911123 15:79227313-79227335 TTCCCATGAAGATTGGACAGGGG - Intergenic
1134214048 16:12302193-12302215 TTTCCATGCCGCTTTGACGGAGG - Intronic
1134879078 16:17728488-17728510 TTTGTATCCATCTTGGACAGGGG + Intergenic
1135877416 16:26216018-26216040 TTTCCCTTGGGCTTGGAGAGGGG - Intergenic
1140143805 16:72285908-72285930 TTTCCATTCTGCGTGGTCAGAGG + Intergenic
1142343383 16:89538373-89538395 TGTCCATTCTGCTTGGACCTGGG - Intronic
1142758222 17:2028237-2028259 CTGCCATTCAGCTTGGGCTGAGG - Intergenic
1149080754 17:52654304-52654326 TTTCCATTCAGCTTACAGAAAGG + Intergenic
1154077913 18:11223563-11223585 CTTACATTCAGCTTTGGCAGTGG - Intergenic
1157196897 18:45626827-45626849 TTCCCATTCAGCCAGGCCAGGGG - Intronic
1159599057 18:70411330-70411352 TTTCCTCTGAGCTTGCACAGAGG - Intergenic
1162525634 19:11204494-11204516 TTTCCACTCAGCTCCCACAGAGG + Intronic
1164751832 19:30661887-30661909 TTTACATTCAGAATGGCCAGTGG + Intronic
1165217269 19:34284699-34284721 TTTCCATGCAGCATGAATAGTGG + Intronic
1166293837 19:41879386-41879408 TTTCAAACCGGCTTGGACAGAGG + Intronic
1168245536 19:55111610-55111632 TATCCTTTCAGCCTGGCCAGCGG + Intronic
925127791 2:1473239-1473261 TTTCCATTCATTTTGCACAGTGG + Intronic
925808527 2:7675679-7675701 TTCCCATTAAGCTTTGACACTGG + Intergenic
927394212 2:22630884-22630906 TCTCCATTCCGCTTGGAAAGTGG - Intergenic
929870823 2:45757844-45757866 TGTACATTCAGTTTTGACAGTGG - Intronic
931698279 2:64888487-64888509 TTACGAATCAGCTTGGACAACGG - Intergenic
931805442 2:65799331-65799353 TTTCCATGGAACATGGACAGTGG + Intergenic
934142600 2:89062385-89062407 TTTCCAGTCTGCTATGACAGAGG + Intergenic
934147317 2:89108196-89108218 TTTCCAGTCTGCTATGACAGAGG + Intergenic
934221955 2:90092398-90092420 TTTCCAGTCTGCTATGACAGAGG - Intergenic
934226643 2:90138169-90138191 TTTCCAGTCTGCTATGACAGAGG - Intergenic
934232660 2:90199449-90199471 TTTCCAGTCTGCTATGACAGAGG - Intergenic
937843467 2:126551710-126551732 TTTCCACTTGGCTTGGTCAGTGG - Intergenic
941493800 2:166175815-166175837 TTTCCATTGATCCTGAACAGGGG + Intergenic
942181028 2:173380866-173380888 TTTCCATTCTGATTGTACCGGGG + Intergenic
945180790 2:207088920-207088942 TTTCCTTTCTGCCTGGACTGTGG - Intronic
946196590 2:218035858-218035880 TTTCCATTCAGCTGGGGCCCAGG + Intronic
946200874 2:218070025-218070047 TTTCCATTCAGCTGGGGCACAGG + Intronic
946201229 2:218071938-218071960 TTTCCATTCAGCTGGGGCACAGG + Intronic
948676072 2:239597463-239597485 TTGCCATGCTGCTTTGACAGAGG - Intergenic
1169182021 20:3577653-3577675 TTTTGATTCAGCTTGCAGAGTGG + Intronic
1170776903 20:19382960-19382982 TTTCCATCCATTTTTGACAGAGG + Intronic
1171417919 20:24995976-24995998 TTTTAATTCAGGTGGGACAGTGG + Intergenic
1172091466 20:32435836-32435858 TCACCATTCACCTTGGACAGTGG - Exonic
1172946299 20:38692359-38692381 TCTACTTTCAGCTTGGCCAGTGG - Intergenic
1173075510 20:39814754-39814776 TCTCCATATAGCTTAGACAGGGG - Intergenic
1173750415 20:45470989-45471011 GTTCCTTTCCGCCTGGACAGAGG - Intronic
1178280842 21:31281506-31281528 TTTACATTGAGCTTAAACAGTGG + Intronic
1181792116 22:25276496-25276518 TTTTCATTCAGGTTGTGCAGTGG + Intergenic
1182278146 22:29203139-29203161 TTTCCACTCAACTAGGAAAGAGG + Intergenic
1183932188 22:41241521-41241543 TAGCCATTCATCTTGGACATTGG + Intergenic
1184260131 22:43310223-43310245 TCCCCCTTCTGCTTGGACAGAGG + Intronic
1185160814 22:49228685-49228707 ATAGCATTCAGCTTGGACAAGGG + Intergenic
950935301 3:16833392-16833414 TCTTCATTCAGCTGGGAAAGGGG + Intronic
951027707 3:17847086-17847108 TTTCCATTCAGTTCTGTCAGTGG + Intronic
951582099 3:24175834-24175856 TTTCCATTCATTTTGCACAGTGG + Intronic
954609645 3:51937575-51937597 TCTCCATGCAGCTTGAGCAGAGG - Exonic
957022598 3:75141690-75141712 TTACGAATCAGCTTGGACAATGG + Intergenic
957611360 3:82471619-82471641 TTTCCATCCAGGATGGAAAGAGG + Intergenic
962087009 3:132201789-132201811 GTTCCTTTCAGCTTGAACAGTGG + Intronic
962352210 3:134664301-134664323 TTGCCTTCCACCTTGGACAGAGG - Intronic
962982397 3:140502336-140502358 TTTGCATACAGGGTGGACAGAGG + Intronic
964556633 3:157946505-157946527 TTTCCACTCACCTGGAACAGTGG + Intergenic
964731820 3:159875569-159875591 TTTGCATTCTCTTTGGACAGTGG + Intronic
965727598 3:171735445-171735467 TTTCCATTCAACTTGTATACTGG + Intronic
966102650 3:176291633-176291655 TTTCCATTCAGCATTTACATGGG + Intergenic
971020076 4:22525902-22525924 TTACTATTCCTCTTGGACAGAGG + Intergenic
971364860 4:25969567-25969589 TCTCCCTTCTGATTGGACAGGGG - Intergenic
975037469 4:69701877-69701899 TTTCCACGCAGCTTTCACAGTGG - Intergenic
976140352 4:81985096-81985118 TTAGCACTCAGGTTGGACAGAGG + Intronic
978480420 4:109183825-109183847 TTACCTTTCAACTTGGACACTGG - Intronic
978830144 4:113073937-113073959 TATCCATTCAACTTGAAGAGAGG + Intronic
984056233 4:174932712-174932734 TTTTCATTTAGTTTGGACAAAGG - Intronic
993256905 5:85603610-85603632 TTTGCTATCAGCTTGCACAGAGG + Intergenic
993903439 5:93599214-93599236 TTTGCTTTCAGCTTGGTTAGAGG - Intergenic
994441330 5:99808402-99808424 TTTTCTTTCAGCTTGGCCACTGG + Intergenic
1002073484 5:176694608-176694630 TTTCCTTTCTGCTTTGCCAGAGG + Intergenic
1002711504 5:181197867-181197889 TTTCCATCCATCTTGGAGTGGGG + Intronic
1004135420 6:12961522-12961544 CTTCCTTTCAGTTTGGACACAGG - Intronic
1005354728 6:24971190-24971212 CTTCCATTCAGAATGGACACTGG + Intronic
1006212465 6:32408456-32408478 TTTTTGTTCAGCTGGGACAGTGG - Intergenic
1006317654 6:33299654-33299676 TATTCATTGAGCTTGGAAAGGGG + Intergenic
1006785456 6:36663535-36663557 TTTTCCTTCAGCTTCCACAGAGG - Intergenic
1012261951 6:97097764-97097786 TTTCCATTCCGATTGTGCAGTGG + Intronic
1012453831 6:99382512-99382534 TTTGCATTAAGCATGGACAAGGG - Intronic
1015397580 6:132752518-132752540 ATTCCATTCAGCTTGGGCAATGG - Exonic
1016523042 6:144968017-144968039 TTTCCCTTCTGCCTGGACAAAGG + Intergenic
1016769882 6:147837404-147837426 TTTCTGTCCAGCTTGGCCAGAGG - Intergenic
1018686899 6:166310093-166310115 TCTCCATTCTGCTGGGACACTGG + Intergenic
1019300028 7:298198-298220 TTACATTTCAGCTTGGACTGGGG - Intergenic
1019616715 7:1966336-1966358 TTTCAAGTCAGCCTGGAGAGAGG + Intronic
1028933671 7:96442268-96442290 TTTCCAGTCAGCTGGGGCTGTGG + Intergenic
1029510904 7:100994382-100994404 TTTCGGTTGAGCTTGGACTGAGG - Exonic
1029511401 7:100997631-100997653 TTTCGGTTGAGCTTGGACTGAGG - Exonic
1029511624 7:100999053-100999075 TTTCGGTTGAGCTTGGACTGAGG - Exonic
1029512121 7:101002302-101002324 TTTCGGTTGAGCTTGGACTGAGG - Exonic
1034561532 7:151882884-151882906 TTTCCTTTAAGCTTGGGCAATGG + Intergenic
1035148482 7:156844526-156844548 TTTCCTTTCATCCTGGACAAAGG - Intronic
1035471054 7:159109073-159109095 TTTACTTTTATCTTGGACAGAGG - Intronic
1037014784 8:13889579-13889601 TTTCCATTCATTTTTGAAAGTGG + Intergenic
1039230729 8:35444696-35444718 CTTCAATTCAGGGTGGACAGTGG - Intronic
1042496209 8:69457481-69457503 ATTTCATTCAGCTGGCACAGTGG + Intergenic
1042988584 8:74612508-74612530 CTTGCCTTCTGCTTGGACAGAGG + Intronic
1043795447 8:84532123-84532145 AAGTCATTCAGCTTGGACAGAGG - Intronic
1046727217 8:117689049-117689071 TTTCCATTCACCTTGGTGACTGG - Intergenic
1047250511 8:123178670-123178692 ATTCCATTTATCTAGGACAGTGG - Intergenic
1048354692 8:133643424-133643446 TTTCCACTTAGCTGGGGCAGTGG - Intergenic
1052188890 9:25633170-25633192 TTTCCTTGCAGATTGGAAAGAGG + Intergenic
1052471441 9:28900654-28900676 TTATCATTCAGCTTGTCCAGAGG - Intergenic
1053105548 9:35405049-35405071 CTTCCATCCAGCCTGTACAGAGG - Exonic
1056139016 9:83656549-83656571 TTTCCTCTAAGCTCGGACAGTGG - Intergenic
1057247481 9:93469046-93469068 TATCCATGCAGCATGGGCAGGGG - Intronic
1059376352 9:113884601-113884623 TTTCCATTGAGTATGGCCAGCGG + Intronic
1059697120 9:116740029-116740051 CTCCCATGGAGCTTGGACAGAGG + Intronic
1059741149 9:117151233-117151255 TTTCTGCTCAGCATGGACAGTGG + Intronic
1061085115 9:128393796-128393818 TTTCCATGCAGCTGGGAGACAGG - Intergenic
1186565215 X:10655072-10655094 TTTTCCTTCAAGTTGGACAGCGG + Intronic
1186984033 X:14991696-14991718 TGTGCATTTAGCTGGGACAGGGG - Intergenic
1189277332 X:39796506-39796528 TTTCCTGGCAGCTTGGACATCGG - Intergenic
1189384851 X:40528847-40528869 TATCCATTCATCTTAAACAGTGG - Intergenic
1190372599 X:49757304-49757326 TTTCCATTCAACCTAGAAAGAGG - Intergenic
1194215166 X:91122351-91122373 TTTCCATTGAGCATGAACAAAGG - Intergenic
1195166814 X:102228118-102228140 TTTGGATTCAGAATGGACAGGGG + Intergenic
1195192046 X:102458970-102458992 TTTGGATTCAGAATGGACAGGGG - Intronic
1196995005 X:121373266-121373288 TTACCAGTCAGCTTGGCTAGAGG + Intergenic
1197861447 X:130975194-130975216 TTTCCATTCATTATGGAAAGGGG + Intergenic
1201940307 Y:19451704-19451726 TTTCCATTAAACTTGTAGAGGGG - Intergenic