ID: 1064166853

View in Genome Browser
Species Human (GRCh38)
Location 10:12994068-12994090
Sequence CTTTAAGTTTCCATTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064166853_1064166857 9 Left 1064166853 10:12994068-12994090 CCAAGCTGAATGGAAACTTAAAG 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1064166857 10:12994100-12994122 ATCAACAGCATCTAGAGGTGGGG No data
1064166853_1064166858 14 Left 1064166853 10:12994068-12994090 CCAAGCTGAATGGAAACTTAAAG 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1064166858 10:12994105-12994127 CAGCATCTAGAGGTGGGGCATGG No data
1064166853_1064166854 4 Left 1064166853 10:12994068-12994090 CCAAGCTGAATGGAAACTTAAAG 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1064166854 10:12994095-12994117 GCAGCATCAACAGCATCTAGAGG No data
1064166853_1064166856 8 Left 1064166853 10:12994068-12994090 CCAAGCTGAATGGAAACTTAAAG 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1064166856 10:12994099-12994121 CATCAACAGCATCTAGAGGTGGG No data
1064166853_1064166855 7 Left 1064166853 10:12994068-12994090 CCAAGCTGAATGGAAACTTAAAG 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1064166855 10:12994098-12994120 GCATCAACAGCATCTAGAGGTGG No data
1064166853_1064166859 17 Left 1064166853 10:12994068-12994090 CCAAGCTGAATGGAAACTTAAAG 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1064166859 10:12994108-12994130 CATCTAGAGGTGGGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064166853 Original CRISPR CTTTAAGTTTCCATTCAGCT TGG (reversed) Intronic
901407295 1:9057851-9057873 CTCCAATTTTCCAATCAGCTGGG + Intronic
902292386 1:15443883-15443905 ATTTAACTTTTAATTCAGCTGGG - Intronic
906466423 1:46084795-46084817 CTTAAAGTTTCCCTTTTGCTGGG - Intronic
908583144 1:65539360-65539382 CTTTGTGTCTCCATTCAGCATGG + Intronic
909158496 1:72113297-72113319 TTTTGAGTCTCCATTCACCTGGG - Intronic
909181575 1:72430312-72430334 CTTGAAGTTTCTATTCAGCATGG + Intergenic
911333521 1:96553349-96553371 ATTTCAGTTTGAATTCAGCTTGG - Intergenic
911409143 1:97479911-97479933 CTTTAAATTCCCTTGCAGCTGGG + Intronic
917550109 1:176018105-176018127 CTTTAAGGTTTTATTCAGGTTGG - Intronic
920445504 1:206013133-206013155 GTTCAAGTTTCAATTCAGCTAGG - Intronic
920860336 1:209700418-209700440 CTTTCAGGCTCCTTTCAGCTGGG + Intronic
920955589 1:210617885-210617907 CTTCATGTATTCATTCAGCTTGG + Intronic
1063190750 10:3692282-3692304 CTTCAAGCTTCCATTAGGCTGGG - Intergenic
1064166853 10:12994068-12994090 CTTTAAGTTTCCATTCAGCTTGG - Intronic
1065106126 10:22387992-22388014 CTTGAAGTTTCTTTTCACCTCGG - Exonic
1066514678 10:36144731-36144753 CTTTAATTTTCCATTCAAAAGGG - Intergenic
1072170325 10:92853358-92853380 CTATAAATTTTCATTCTGCTGGG - Intronic
1072362088 10:94669511-94669533 CTTTTAGTTTCCATTTTCCTAGG + Intergenic
1072612228 10:97025514-97025536 CTTGTAGTTTGCATTCATCTGGG + Intronic
1072903957 10:99433575-99433597 CTTGAATTATCCATTCAGCAAGG - Intergenic
1076495748 10:130896599-130896621 CTCTAAATTTCCATCCAGCTGGG - Intergenic
1077714522 11:4568275-4568297 ATGTAAGTTTCCCTACAGCTTGG - Intergenic
1078694560 11:13618318-13618340 CTTTAAGATACCATACAGTTGGG + Intergenic
1079065584 11:17288486-17288508 CTTTAAGATTCCATTGGGCTGGG - Intronic
1079422201 11:20304091-20304113 CTTTATCTTTCCATTGAACTCGG + Intergenic
1080067794 11:28040083-28040105 CTTTTAGTTTTCATTAAGTTGGG - Intronic
1082182263 11:49133817-49133839 CTTTCAGATTCCATTCTGATGGG + Intergenic
1088346488 11:108832621-108832643 CTTTATGTTGCCAATCAACTAGG - Intronic
1088367725 11:109056719-109056741 TTTTAAGTTTCCATTCAGCCTGG - Intergenic
1090042756 11:123305054-123305076 CATTAAGATCCCATTCAGCTTGG + Intergenic
1091360654 11:134976471-134976493 CAGAAACTTTCCATTCAGCTCGG - Intergenic
1093148515 12:15595237-15595259 CTTTGAGTTTCAATGCACCTTGG + Intronic
1093209213 12:16287584-16287606 CTTTCATTTTCCATTCACTTTGG + Intergenic
1099220185 12:79904360-79904382 CTTTGAGTTTCCAGTCTGTTCGG - Intronic
1099294570 12:80814003-80814025 TTTTGAGTTTCCCTTCTGCTTGG - Intronic
1100192384 12:92206686-92206708 TTTTAGGGTTCCCTTCAGCTGGG + Intergenic
1104160393 12:126173733-126173755 GTTTAAGTTTCCCTTTACCTTGG + Intergenic
1104873007 12:132014209-132014231 ATTTTAGTTTCCATTCATCCGGG + Intronic
1104936307 12:132366236-132366258 CTTTCAGTTGCTTTTCAGCTGGG - Intergenic
1105957739 13:25300442-25300464 CTTTAATCTTCCGTTGAGCTTGG - Intergenic
1107401763 13:40076484-40076506 AATTAAGTCTCGATTCAGCTTGG - Intergenic
1107773539 13:43813458-43813480 CTCTGAGTCTCCATACAGCTTGG + Intergenic
1107972606 13:45658388-45658410 CTTGAAATTTTCATTCAGCGTGG + Intergenic
1109888698 13:68578346-68578368 CTTTAAATTTCCTTTCAACCTGG - Intergenic
1112722580 13:102261290-102261312 CAATAAGTTTTAATTCAGCTTGG + Intronic
1114311923 14:21475808-21475830 CTTCAGGTTTCCATACAGGTGGG + Intronic
1114331654 14:21642991-21643013 CTTTATGTTTCCATGAAGATGGG + Intergenic
1118024484 14:61755113-61755135 CTTTAAGCTGCCATTCTGCTAGG - Intergenic
1118222922 14:63872133-63872155 CTTTAAGATTCTATCCAGCTTGG + Intronic
1119476316 14:74931924-74931946 TCTGAAGTTTGCATTCAGCTTGG + Intergenic
1120123118 14:80706622-80706644 CTTTTAGGGTTCATTCAGCTTGG + Intronic
1121856345 14:97273659-97273681 CTCTAAGATTCCATTCTCCTTGG + Intergenic
1123765456 15:23473561-23473583 CTAGAAGTTTGCTTTCAGCTGGG - Intergenic
1124611731 15:31214296-31214318 GTTTAAGGTTCCTTTCACCTTGG + Intergenic
1126211290 15:46103894-46103916 CTTTAAGTTTCCTTTTACGTGGG + Intergenic
1127626245 15:60782836-60782858 CTATCAGTTTCCATGCAGCTTGG - Intronic
1131885117 15:96903985-96904007 CTTTAAGTTTCGATTGTTCTAGG - Intergenic
1134464644 16:14464202-14464224 CTTCAAGTTTCTAATCAGCTTGG - Intronic
1135778306 16:25276395-25276417 CTTTAACTTTCCAGGTAGCTGGG - Intergenic
1136952324 16:34736744-34736766 CTATAAGTTTCCATTCAATGAGG + Intergenic
1138150406 16:54651351-54651373 CTATAAGTTCCCTGTCAGCTTGG - Intergenic
1138302897 16:55947506-55947528 CATAAAGCTTCCATTCTGCTTGG + Intronic
1140696797 16:77542901-77542923 TTCTAATTTTCCATTCATCTGGG - Intergenic
1140698548 16:77559716-77559738 GTTTCAGTTTGCATTAAGCTTGG - Intergenic
1142438135 16:90076207-90076229 CTTTTAGTTCCCCTGCAGCTTGG + Intronic
1144347735 17:14365196-14365218 TTTTATGATTCCATTCAGATAGG - Intergenic
1144616842 17:16783859-16783881 CCTTCAGTTCCCATTCAGTTTGG + Intronic
1144803848 17:17950842-17950864 CTTGCAGTTTCCATTCTCCTGGG - Intronic
1144895849 17:18531815-18531837 CCTTCAGTTCCCATTCAGTTTGG - Intergenic
1145136368 17:20412417-20412439 CCTTTAGTTCCCATTCAGTTTGG + Intergenic
1148971029 17:51481820-51481842 CTTTAAGTTTTCTGTCTGCTAGG + Intergenic
1150023204 17:61642077-61642099 CTTAAAGTTTCAATTCAGGAAGG + Intergenic
1150198511 17:63327464-63327486 CTTAAAGAATCCATTCAGCTTGG - Intronic
1152472258 17:80496406-80496428 CTTCAACTTTCCAGACAGCTGGG + Intergenic
1153840389 18:9002232-9002254 CACTAAGTTTCTATTCAGCTGGG - Intergenic
1155426033 18:25708559-25708581 CTTTAAGATCCCCTCCAGCTGGG + Intergenic
1156841245 18:41612278-41612300 ATTTAAGTTTACATCCAGCTGGG + Intergenic
1158385876 18:56991005-56991027 CATTCAGTTCCCATTCAGGTTGG + Intronic
1158466572 18:57695807-57695829 CTTTAACTTTACCATCAGCTAGG + Intronic
1159110705 18:64053216-64053238 CTTTAACATTCCCTTCAGCTTGG - Intergenic
1160260399 18:77288629-77288651 TGTTAAGTTTCCATGCAGTTGGG + Intergenic
1164217900 19:23166911-23166933 CTTTAAATGTCTATTCAGGTGGG + Intergenic
1164284914 19:23805456-23805478 CTATAAGTTTCTCTGCAGCTGGG - Intronic
1164682287 19:30144047-30144069 CTTTACTTTTCCCTTCAGATGGG + Intergenic
927279259 2:21289405-21289427 CTTTGACTTTTCATTAAGCTGGG + Intergenic
930863588 2:56100866-56100888 CTTTTTGTTTCAATTCAACTGGG - Intergenic
933719852 2:85390966-85390988 CTTTAAGCCTCCATTCATCTCGG - Exonic
935097502 2:99959648-99959670 GTTCATGTTTCCATTCAACTCGG - Intronic
935891667 2:107685767-107685789 CAGTATGCTTCCATTCAGCTCGG - Intergenic
940416639 2:153430601-153430623 CTTTAAGTATCCATTGATCTCGG + Intergenic
942967499 2:181914834-181914856 CTTTGAGTTTCCTTTCAGAATGG + Intronic
945065746 2:205946436-205946458 CTTCAAGTTTCCATCCCCCTGGG - Intergenic
945841415 2:214892026-214892048 ATTTAAGTTTCCATTGTTCTTGG - Intergenic
945842275 2:214901918-214901940 CTTTAAATTTCTTTGCAGCTAGG - Intergenic
1168756813 20:324329-324351 CTTTAAGGTGGCATTCCGCTGGG - Intergenic
1169720649 20:8672814-8672836 ATTTAAAGTTACATTCAGCTGGG + Intronic
1177561335 21:22758426-22758448 CTTTAACCTTCCCTTTAGCTGGG + Intergenic
1178110125 21:29361651-29361673 CATTAATTTGCCATTCAGTTTGG - Intronic
1180941840 22:19664625-19664647 CTTAAGTTTTCCATTCATCTGGG - Intergenic
1181941246 22:26479084-26479106 CTTAAAATTTCCAGGCAGCTCGG - Intronic
1183010816 22:34945067-34945089 CTTTAAGATACTATTCAGGTGGG - Intergenic
1184130101 22:42512523-42512545 CTTTTATTTTCCATCCAGTTGGG - Exonic
1184140279 22:42574345-42574367 CTTTTATTTTCCATCCAGTTGGG - Exonic
949454079 3:4219834-4219856 CTTTAAGGCTGGATTCAGCTTGG - Intronic
956555124 3:70512961-70512983 CTTTCAGCTTCCTTCCAGCTGGG + Intergenic
960329287 3:116338550-116338572 CTTTTATTTTCAATTCAGGTAGG + Intronic
960691176 3:120348453-120348475 TTTTGAGTTTCCACTCAGTTTGG + Intronic
960816326 3:121676938-121676960 CTTTAAGCTGTCATTGAGCTGGG + Exonic
961207828 3:125100701-125100723 CTTTAAGATAGCATTAAGCTGGG - Intronic
961235763 3:125365520-125365542 CTCTAAATTTCCAGTCAGCCAGG + Intronic
965011616 3:163100404-163100426 CTTTTAAACTCCATTCAGCTTGG - Intergenic
966497230 3:180594869-180594891 ATTTCAGTTTCAATTCAGCATGG - Intergenic
966580257 3:181553617-181553639 ATTTGAGTTTTCATTCAGTTAGG + Intergenic
967853807 3:194101464-194101486 CCTGAAGTTTGCAGTCAGCTAGG - Intergenic
970625471 4:17873653-17873675 CTTTAAGATCTCATTCTGCTAGG - Intronic
970856741 4:20657979-20658001 TTTTAAGATTCCATTCATGTGGG + Intergenic
971463609 4:26929795-26929817 CTTTAAGTGAACATTCAGGTAGG + Intronic
976821668 4:89213976-89213998 CTTTGAGTTCCCATTCACCAGGG + Intergenic
977724517 4:100279929-100279951 CTTGGAGATTGCATTCAGCTGGG + Intergenic
977894300 4:102346142-102346164 CTTGATGTTTCCCTTTAGCTTGG - Intronic
978447689 4:108796101-108796123 CTTTATATTTCCATACTGCTTGG - Intergenic
978570994 4:110137255-110137277 ACTTAAGTTTCCACTCAGCTGGG - Intronic
980454246 4:133018672-133018694 CTTAAAATATTCATTCAGCTGGG - Intergenic
981921629 4:150091029-150091051 CTTTAAGTTTACATTCTGTGCGG + Intronic
987197598 5:15542974-15542996 CCTTAAATTTCCTTTCAGCATGG - Intronic
987862966 5:23508716-23508738 CTTTTAGTTCCCCTGCAGCTAGG - Intronic
993148419 5:84127327-84127349 CTTTATGTTTCCATTCCCTTTGG + Intronic
993620410 5:90161610-90161632 CTCTTAGTTTTCATTGAGCTGGG - Intergenic
993962039 5:94309879-94309901 CTTTAGGATTCTATTTAGCTGGG + Intronic
995354461 5:111222989-111223011 TTTTCAATTTCCAATCAGCTAGG + Intergenic
1001523810 5:172414501-172414523 TTTCCAGTTTCCATTGAGCTAGG - Intronic
1003367824 6:5493500-5493522 CTTTGACTTTCCATTCCTCTTGG - Intronic
1003774510 6:9345117-9345139 TTTTAGGTTTCCACTGAGCTTGG - Intergenic
1003894681 6:10596226-10596248 GTTAAGATTTCCATTCAGCTGGG + Intronic
1006830692 6:36966505-36966527 CGTTAAGTTTCCAATTATCTTGG + Intergenic
1006864654 6:37199651-37199673 CCTTAAGATTCCTTTCAGCTTGG + Intergenic
1008332940 6:50264112-50264134 CTCTCAGTTTCCTTTCAGTTTGG - Intergenic
1008823702 6:55665384-55665406 CTATAAGTTTTCATTCATCAGGG + Intergenic
1009411355 6:63368718-63368740 CATTAAGTTTACATTCTGGTAGG - Intergenic
1011704935 6:89991334-89991356 CTTTTAGTCTGGATTCAGCTGGG + Intronic
1011839947 6:91485006-91485028 CTTTAATTTTCTACTAAGCTAGG + Intergenic
1012392350 6:98756902-98756924 CTTTATGTGTCAACTCAGCTAGG - Intergenic
1013034222 6:106364504-106364526 CTTAAAGTTTTTTTTCAGCTTGG + Intergenic
1013807223 6:114009518-114009540 CTTGAATTTTCCCTTCAGCTTGG + Intronic
1014615829 6:123598202-123598224 CTTTCACTTTCCATTGATCTTGG - Intronic
1015017695 6:128434158-128434180 CTTTTTGTTTGCATTCACCTGGG - Intronic
1015313963 6:131795959-131795981 CTTTCAGTGTCTATTCTGCTTGG + Intergenic
1019182106 6:170193888-170193910 ATTTATTTTTCCATTCAGTTTGG - Intergenic
1021401650 7:20216631-20216653 AATTAAGTTTCAATTAAGCTTGG - Intronic
1021986651 7:26103596-26103618 CTACAAGTTTCCTTTGAGCTTGG - Intergenic
1022669512 7:32442722-32442744 CTGAAAGTTTTCACTCAGCTAGG + Intergenic
1023545077 7:41310297-41310319 CTGAAACTTTCCCTTCAGCTGGG - Intergenic
1024716594 7:52086569-52086591 AGCTATGTTTCCATTCAGCTGGG - Intergenic
1028348651 7:89816209-89816231 CTTTAATTTTCTATTCCACTTGG + Intergenic
1028676178 7:93464445-93464467 CTTTTAGTTTTCATTTACCTAGG + Intronic
1030052042 7:105546576-105546598 CTTTAAATTTGCTTTCGGCTGGG + Intronic
1031548905 7:123084684-123084706 CTGTAAGTTTCATCTCAGCTGGG + Intergenic
1032058442 7:128703465-128703487 ATTTTTGTTTTCATTCAGCTGGG - Intergenic
1038478843 8:27887513-27887535 CTTGGTGTTTCCCTTCAGCTTGG - Intronic
1039377019 8:37044909-37044931 GTTTGAGCTTCCATCCAGCTAGG + Intergenic
1041241870 8:55855130-55855152 CTTTTCTTTCCCATTCAGCTTGG + Intergenic
1042608654 8:70573609-70573631 GTTTAAGTTGCCATGCTGCTAGG - Exonic
1044890933 8:96834923-96834945 CTTACAGTTTCCCATCAGCTGGG - Intronic
1045426771 8:102074887-102074909 CATTATGATTCCATTCAGCTGGG + Intronic
1045687050 8:104723023-104723045 TTTAGAGTCTCCATTCAGCTTGG + Intronic
1045851212 8:106700434-106700456 CTCAAAGTTCCCATACAGCTGGG - Intronic
1048012293 8:130467572-130467594 CCGTAAGTTTCCATTCTCCTGGG + Intergenic
1048178423 8:132173241-132173263 CTTCAAGTTCTCTTTCAGCTTGG - Intronic
1048584665 8:135763767-135763789 GCTTAATTTCCCATTCAGCTTGG + Intergenic
1049183821 8:141238235-141238257 CTATAAGTCTCCAGTCAGCAGGG + Intronic
1051239380 9:15037085-15037107 CTTTAAGTGTTTATCCAGCTTGG - Intergenic
1052256370 9:26461560-26461582 CTTAAGGTTTCCATTCAGAAGGG + Intergenic
1052936409 9:34096942-34096964 ATTTAATATGCCATTCAGCTAGG - Intronic
1053025084 9:34722940-34722962 CTTTAACTTACCTTTCAGATGGG - Intergenic
1054959322 9:70949698-70949720 CTTTAAGATTACATTCAGGTTGG - Intronic
1055362162 9:75503937-75503959 CTCTAAGTTTCCTTTCAGAATGG - Intergenic
1055898923 9:81212277-81212299 CTTGAAGAGTCCAATCAGCTCGG + Intergenic
1059142448 9:111866438-111866460 GTTTAAGTCTCCATTCTACTTGG + Intergenic
1059906470 9:118991974-118991996 CTTTAAGCTTCCCAGCAGCTGGG + Intergenic
1061085116 9:128393803-128393825 CCTTTGGTTTCCATGCAGCTGGG - Intergenic
1187256859 X:17651205-17651227 GTTTAAGTCTCCAGTGAGCTGGG - Intronic
1188308685 X:28589625-28589647 ATTTAACTTTCCATTCAGTTGGG - Intronic
1190427174 X:50344876-50344898 CTTTCATTTTTCCTTCAGCTAGG + Intronic
1190461217 X:50677798-50677820 CAATAAGTTTCCATAAAGCTAGG - Intronic
1190892586 X:54583610-54583632 CTTTAAGTTTGCATCCATTTTGG + Intergenic
1192861684 X:75080190-75080212 ATATAAGTTTCCATTCATCTGGG + Intronic
1193815142 X:86095998-86096020 CTGTAACTTGCCATTCAACTTGG - Intergenic
1195921882 X:109992003-109992025 CTTTAATATTCCTTTCAACTGGG - Intergenic
1196549078 X:116999709-116999731 TTCTAAGTGTCCTTTCAGCTGGG + Intergenic
1198503404 X:137276929-137276951 TTTTGATTTTCCATTCAGTTAGG - Intergenic
1198562722 X:137868162-137868184 CCTTCAGTCTCCATTCAGCGTGG + Intergenic
1198576705 X:138018064-138018086 CTTTAAGTTTCCATTGATGGAGG - Intergenic
1200481911 Y:3715495-3715517 CTTTAAATTTTCTTTCAGATAGG - Intergenic
1201051036 Y:9935614-9935636 CTTTATGTTTCCATTCCATTAGG - Intergenic
1201533511 Y:15019159-15019181 ATTTAATTTTCAATTCAGATTGG - Intergenic