ID: 1064166855

View in Genome Browser
Species Human (GRCh38)
Location 10:12994098-12994120
Sequence GCATCAACAGCATCTAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064166853_1064166855 7 Left 1064166853 10:12994068-12994090 CCAAGCTGAATGGAAACTTAAAG 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1064166855 10:12994098-12994120 GCATCAACAGCATCTAGAGGTGG No data
1064166850_1064166855 20 Left 1064166850 10:12994055-12994077 CCAGATCCACTGTCCAAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1064166855 10:12994098-12994120 GCATCAACAGCATCTAGAGGTGG No data
1064166852_1064166855 14 Left 1064166852 10:12994061-12994083 CCACTGTCCAAGCTGAATGGAAA 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1064166855 10:12994098-12994120 GCATCAACAGCATCTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064166855 Original CRISPR GCATCAACAGCATCTAGAGG TGG Intronic
No off target data available for this crispr