ID: 1064166858 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:12994105-12994127 |
| Sequence | CAGCATCTAGAGGTGGGGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064166852_1064166858 | 21 | Left | 1064166852 | 10:12994061-12994083 | CCACTGTCCAAGCTGAATGGAAA | 0: 1 1: 0 2: 0 3: 16 4: 161 |
||
| Right | 1064166858 | 10:12994105-12994127 | CAGCATCTAGAGGTGGGGCATGG | No data | ||||
| 1064166850_1064166858 | 27 | Left | 1064166850 | 10:12994055-12994077 | CCAGATCCACTGTCCAAGCTGAA | 0: 1 1: 0 2: 0 3: 15 4: 140 |
||
| Right | 1064166858 | 10:12994105-12994127 | CAGCATCTAGAGGTGGGGCATGG | No data | ||||
| 1064166853_1064166858 | 14 | Left | 1064166853 | 10:12994068-12994090 | CCAAGCTGAATGGAAACTTAAAG | 0: 1 1: 0 2: 1 3: 22 4: 171 |
||
| Right | 1064166858 | 10:12994105-12994127 | CAGCATCTAGAGGTGGGGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064166858 | Original CRISPR | CAGCATCTAGAGGTGGGGCA TGG | Intronic | ||
| No off target data available for this crispr | |||||