ID: 1064167696

View in Genome Browser
Species Human (GRCh38)
Location 10:13001217-13001239
Sequence GTAGTCCTGGACCACGGTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064167692_1064167696 -2 Left 1064167692 10:13001196-13001218 CCTGAGGAAGAAGAAATAGGAGT 0: 1
1: 0
2: 1
3: 48
4: 415
Right 1064167696 10:13001217-13001239 GTAGTCCTGGACCACGGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1064167689_1064167696 10 Left 1064167689 10:13001184-13001206 CCGCCGGGCTCACCTGAGGAAGA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1064167696 10:13001217-13001239 GTAGTCCTGGACCACGGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1064167690_1064167696 7 Left 1064167690 10:13001187-13001209 CCGGGCTCACCTGAGGAAGAAGA 0: 1
1: 0
2: 5
3: 29
4: 283
Right 1064167696 10:13001217-13001239 GTAGTCCTGGACCACGGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064167696 Original CRISPR GTAGTCCTGGACCACGGTGT GGG Exonic
900738746 1:4317449-4317471 GAAGTCCAAGACCAAGGTGTGGG - Intergenic
900822357 1:4899351-4899373 GAAGTCCAAGACCAAGGTGTAGG + Intergenic
907182688 1:52584666-52584688 GAAGTCCAAGACCAAGGTGTTGG - Intergenic
917015526 1:170527702-170527724 GGAGTCCAAGACCAAGGTGTTGG + Intergenic
918157414 1:181862549-181862571 GAAGTCCTAGATCAAGGTGTTGG - Intergenic
918586818 1:186197718-186197740 GAAGTCCTAGATCAAGGTGTTGG + Intergenic
1063674386 10:8127070-8127092 GTGGTCCTGGACCACGATCCAGG - Intergenic
1064167696 10:13001217-13001239 GTAGTCCTGGACCACGGTGTGGG + Exonic
1066672763 10:37857760-37857782 GAAGTCCTGTAGCACGGGGTAGG - Intronic
1077999475 11:7482060-7482082 GAAGTCCCAGATCACGGTGTGGG + Intergenic
1081338189 11:41894270-41894292 GTACTCCTGGAACACAGTGAAGG + Intergenic
1081638743 11:44738548-44738570 GAAGTCCATGACCATGGTGTTGG + Intronic
1092124698 12:6066854-6066876 GCAGTACTGGACCCAGGTGTGGG + Intronic
1092209979 12:6639688-6639710 GAAGTCCTGGATCACAGGGTTGG + Intronic
1092778314 12:11963028-11963050 GAAGTCCAGGGTCACGGTGTGGG - Intergenic
1092800211 12:12157338-12157360 GTAGACCTGGACAATGGTGGTGG - Intronic
1095417187 12:41989818-41989840 GAAGTCTTGGATCAAGGTGTTGG - Intergenic
1098160407 12:67643976-67643998 GTAGTTCTGGACCTTGGTGATGG + Intergenic
1102030089 12:109735300-109735322 GCTGTCCAGGACCACGGGGTTGG - Intronic
1102412246 12:112730162-112730184 GAAGTCCAAGACCAAGGTGTCGG - Intronic
1104573363 12:129944836-129944858 GGTGTCCTGGACCAGGGTGGTGG - Intergenic
1106507246 13:30381868-30381890 GAAGTCTGAGACCACGGTGTGGG + Intergenic
1106603019 13:31203328-31203350 GTAGTCCAGGACCTCCGAGTTGG + Intronic
1111732045 13:92088407-92088429 GAAGTCCTGGACCACAGCTTTGG + Intronic
1112097575 13:96151667-96151689 GAAGTCCTAAACCAAGGTGTCGG + Intronic
1112935999 13:104799255-104799277 GAAGTCCAAGACCAAGGTGTTGG + Intergenic
1113268506 13:108645919-108645941 GTAGTCCTGCCCCAGGGTGCAGG + Intronic
1116751695 14:48894285-48894307 GAAGTCCAGGATCAAGGTGTTGG + Intergenic
1120883017 14:89429131-89429153 GTGATCCTGGACCTCCGTGTTGG + Intronic
1122704138 14:103609487-103609509 GAAGTTCTAGATCACGGTGTTGG - Intronic
1122704398 14:103611053-103611075 GAAGTTCTAGATCACGGTGTTGG - Intronic
1123670525 15:22652159-22652181 GAAGTCCTGGACCACAGCTTTGG + Intergenic
1124526507 15:30458596-30458618 GAAGTCCTGGACCACAGCTTTGG + Intergenic
1124772147 15:32549087-32549109 GAAGTCCTGGACCACAGCTTTGG - Intergenic
1127314197 15:57779173-57779195 GAAGTCCAAGACCACGGTGATGG - Intronic
1129056246 15:72822475-72822497 GAAGTCCAAGACCAAGGTGTTGG + Intergenic
1129936119 15:79451521-79451543 GGAGGCCTGGGCTACGGTGTTGG + Intronic
1136527597 16:30842279-30842301 GAAGTCCAAGACCAAGGTGTCGG - Intronic
1137267419 16:46880673-46880695 GTTGGCCTGGACCAGGGTGTGGG - Intergenic
1137763663 16:50960936-50960958 CTAGTCCTGGCACACAGTGTGGG - Intergenic
1150632067 17:66886818-66886840 GGAGTCCAAGATCACGGTGTTGG + Intergenic
1152422627 17:80202318-80202340 GCAGCCCTGGAACATGGTGTCGG - Exonic
1152448355 17:80360078-80360100 GTGGTTCTGCACCACGATGTAGG - Exonic
1160042750 18:75360581-75360603 GTGGTCCTGGACCATGCTGGTGG - Intergenic
1160506490 18:79429841-79429863 GCAGTCCTGCACCGCGGCGTCGG + Intronic
1160833486 19:1113840-1113862 GCAGTCCTGGGCCACGGTGCCGG - Intronic
1162547384 19:11339039-11339061 GTTCTCCTGGAACACGGGGTGGG - Intronic
1163288788 19:16365179-16365201 GTGGCCCTGGAAGACGGTGTGGG + Intronic
1165204485 19:34172312-34172334 GTTGGCCTGGACTACGGTGGTGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1167044192 19:47040396-47040418 GGAGTCCAAGACCACGGGGTTGG - Intronic
1167491571 19:49795643-49795665 GTAGTCCTGGAGGTCGGTGGAGG - Exonic
925352949 2:3215040-3215062 GAAGTCCAGGATCAAGGTGTTGG - Intronic
935192242 2:100787695-100787717 GAAGTCCAAGACCAAGGTGTTGG + Intergenic
936677746 2:114734897-114734919 GAAGTCCAAGACCAAGGTGTTGG + Intronic
941956397 2:171209829-171209851 GAAGTCCAAGACCAAGGTGTAGG - Intronic
945792633 2:214324494-214324516 GAAGTAGTAGACCACGGTGTGGG - Intronic
948288006 2:236802241-236802263 GGAGTCCAAGACCAAGGTGTCGG + Intergenic
948293718 2:236845878-236845900 GAAGTCCTAGATCACAGTGTTGG + Intergenic
1178502960 21:33140801-33140823 GGAGTCCTGGACCCCTGTGGGGG + Intergenic
1179186616 21:39089824-39089846 GGAGTCCAGGATCAAGGTGTGGG - Intergenic
1182740601 22:32564583-32564605 GTAGTCCGGGAGCACTGTTTGGG - Intronic
1182740644 22:32564819-32564841 GTAGTCCGGGAGCACTGTTTGGG - Intronic
1182992569 22:34782161-34782183 GAAGTCCTTGATCAGGGTGTCGG + Intergenic
1183263348 22:36810558-36810580 GTGGGCCTGGACCATGCTGTTGG + Intronic
1183875248 22:40774956-40774978 GGTGGCCTGGACCACGGTGGTGG - Intronic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185268858 22:49919057-49919079 GGACTCCAGGACCACGGTGGAGG - Intronic
949791200 3:7793856-7793878 GGAGTCCTAGATCAAGGTGTTGG - Intergenic
958458103 3:94358589-94358611 GAAGTCCAGGATCAAGGTGTTGG - Intergenic
964881757 3:161431177-161431199 GAAGTCCAAGACCACGGTGCTGG + Intergenic
965657477 3:171003786-171003808 GAATTGCTGGACCATGGTGTAGG + Intronic
968508735 4:985460-985482 TGTGTCCTGCACCACGGTGTGGG + Intronic
972211440 4:36842736-36842758 GGAGGCCTGGACCAGGATGTTGG - Intergenic
974292001 4:59944826-59944848 GTAGGCCTGGCCCAGGGTTTAGG - Intergenic
976100856 4:81561642-81561664 GGAGTCCTGGATCATGGTTTAGG + Intronic
978526813 4:109675890-109675912 GAAGTCCAAGACCAAGGTGTTGG - Intronic
982382128 4:154760461-154760483 GAAGTCCACGACCAAGGTGTTGG - Intergenic
988868897 5:35366484-35366506 GAAGTCCTGGATCAATGTGTCGG - Intergenic
992751641 5:79868057-79868079 GAAGTCCAGGACCAAGGTGTCGG + Intergenic
996535143 5:124570046-124570068 GGACGCCTGGACCACGGTGGAGG + Intergenic
998537962 5:142951915-142951937 GAAGTCCTGAACCAAGGTGTTGG + Intronic
1002337812 5:178492462-178492484 GAAGTCCAGGATCAAGGTGTTGG - Intronic
1003114296 6:3273133-3273155 GTAGTCCTTGAGCTCGGCGTTGG + Exonic
1008205075 6:48645471-48645493 GAAGTCCTCGACCAAGGTGCTGG + Intergenic
1008270118 6:49481809-49481831 GGAGTGCTGGCACACGGTGTGGG - Intronic
1011613482 6:89176620-89176642 GAAGTCCAAGACCAAGGTGTTGG - Intergenic
1015275627 6:131380881-131380903 GAAGTCCGAGACCAAGGTGTTGG - Intergenic
1016810360 6:148255223-148255245 GAAGTCCAAGACCAAGGTGTTGG + Intergenic
1019384589 7:747457-747479 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019384629 7:747689-747711 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019384642 7:747747-747769 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019384664 7:747863-747885 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019384677 7:747921-747943 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019384699 7:748037-748059 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019384712 7:748095-748117 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019384734 7:748211-748233 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019384747 7:748269-748291 GCAGTGGTGGCCCACGGTGTTGG + Intronic
1019793577 7:3033368-3033390 GAAGTCCTGGATCAAGGTGCCGG - Intronic
1023032386 7:36101837-36101859 GGAGTCCTGGGCCACTGTGTAGG - Intergenic
1024595832 7:50936608-50936630 GCAGTCCTGTAGCACGGTGATGG - Intergenic
1033329191 7:140404078-140404100 GTAGTTCTGGCCCCAGGTGTCGG - Exonic
1033949641 7:146768353-146768375 GCAGTCCTGGAGCACTGAGTTGG - Intronic
1034987270 7:155524048-155524070 GAAGTCCAGGACCATGGTGTTGG - Intronic
1037727840 8:21497949-21497971 GAAGTCCAGGATCAAGGTGTTGG - Intergenic
1039460041 8:37736431-37736453 GCGGTCCTGGACCTCGGTCTTGG - Exonic
1042793151 8:72631295-72631317 GAAGTCCTAGATCAAGGTGTTGG + Intronic
1048259160 8:132931078-132931100 GAAGTCCAGGATCAAGGTGTTGG + Intronic
1049797054 8:144501647-144501669 CTTGTCGTGGACCAGGGTGTGGG - Exonic
1049968910 9:804168-804190 GCAGGCCTGGACAAAGGTGTGGG - Intergenic
1055962906 9:81837138-81837160 GTAGTCCGAGATCAAGGTGTGGG - Intergenic
1060206368 9:121684974-121684996 GTAGTGCTGGACCCCTGGGTGGG + Intronic
1060302286 9:122381748-122381770 GTAGTGCTGGGCCAGGGGGTAGG + Intronic
1061508555 9:131046684-131046706 GGAGTCAGGGACCACGGTATAGG - Intronic
1062392288 9:136338629-136338651 GTAGTCCTGCAGCAGCGTGTAGG - Exonic
1187527379 X:20066361-20066383 GAAGGCCTGGCCCACAGTGTAGG + Intronic
1189808087 X:44754938-44754960 GAAGTCCTAGACCAAGGTGCTGG - Intergenic
1190009742 X:46774340-46774362 GAAGTCCAAGACCAAGGTGTTGG + Intergenic
1192182397 X:68924378-68924400 TGAGACCTGGACCACGGTGGAGG - Intergenic
1194310563 X:92301132-92301154 GTAGGCCAGGGCCACGATGTTGG + Intronic