ID: 1064168117

View in Genome Browser
Species Human (GRCh38)
Location 10:13003891-13003913
Sequence ATGTGTCTGCTGAATCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064168117_1064168123 29 Left 1064168117 10:13003891-13003913 CCTCATGGATTCAGCAGACACAT 0: 1
1: 0
2: 2
3: 12
4: 212
Right 1064168123 10:13003943-13003965 GGCAGAGTGCCTCACTGATTGGG No data
1064168117_1064168122 28 Left 1064168117 10:13003891-13003913 CCTCATGGATTCAGCAGACACAT 0: 1
1: 0
2: 2
3: 12
4: 212
Right 1064168122 10:13003942-13003964 TGGCAGAGTGCCTCACTGATTGG No data
1064168117_1064168118 8 Left 1064168117 10:13003891-13003913 CCTCATGGATTCAGCAGACACAT 0: 1
1: 0
2: 2
3: 12
4: 212
Right 1064168118 10:13003922-13003944 CTTTTCTCCCCTGTAAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064168117 Original CRISPR ATGTGTCTGCTGAATCCATG AGG (reversed) Intronic
900715092 1:4139082-4139104 ATGTGTCTGCTGCATTCTTGGGG - Intergenic
901198175 1:7451919-7451941 ATGAGGCTGCTGACTCCTTGTGG - Intronic
901322529 1:8348518-8348540 GTGTGTCTGCAGAATCCACTCGG + Intergenic
901523060 1:9800410-9800432 ATGTATCTTTTTAATCCATGGGG - Intronic
901939826 1:12653437-12653459 ACGTCACTGCTGAAGCCATGTGG - Intronic
902252622 1:15164759-15164781 AGTTGTGTTCTGAATCCATGCGG + Intronic
902998945 1:20250645-20250667 ATGTTTCTCCTGTGTCCATGGGG - Intergenic
903414333 1:23171329-23171351 GTGACTCTGCTGAATCCATCTGG - Intronic
903753969 1:25647805-25647827 ATGTGTGAGTTGAATGCATGTGG + Intronic
905240692 1:36579164-36579186 GTGTGTGGGCTGAATGCATGTGG - Intergenic
905251527 1:36651897-36651919 ATGTTTCTGCTGGTTCCAGGAGG + Intergenic
906911507 1:49956748-49956770 ATTTGTCTCCTTATTCCATGAGG - Intronic
907862322 1:58365464-58365486 ATGTGTCTGGTGACTGCGTGAGG + Intronic
908288724 1:62639922-62639944 AATTGTGTACTGAATCCATGAGG - Intronic
909428024 1:75550402-75550424 ATGTGACTGCTTAATGGATGAGG + Intronic
911771962 1:101755104-101755126 ATGTGTTTGCTTAATGCATTCGG - Intergenic
918257427 1:182761986-182762008 TTGGTTCTGCTGAATTCATGTGG + Intergenic
919431320 1:197496001-197496023 CTGTATCTGCCGAATCCCTGAGG + Intergenic
919770757 1:201156844-201156866 ATTTGTCTGTTGTATCCCTGGGG - Intronic
919973121 1:202593450-202593472 TTGTGTCTGCAGAATCAGTGTGG - Exonic
922616362 1:226963382-226963404 AAGTATCTGCTGAATGAATGTGG - Intronic
922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG + Intronic
922939569 1:229449967-229449989 ATGAGTCTCTTGAATCCAGGAGG - Intronic
923373811 1:233339946-233339968 AAGTGTTTGCTGAATGAATGAGG - Intronic
1063232896 10:4083325-4083347 ACGTGTGTGCCGAATCCAGGTGG + Intergenic
1063245136 10:4209808-4209830 GTGAGTCTGCTGAAGCCAGGTGG + Intergenic
1064168117 10:13003891-13003913 ATGTGTCTGCTGAATCCATGAGG - Intronic
1064945822 10:20788133-20788155 ATATGTCTGCTGATTCTGTGGGG - Intronic
1066499652 10:35978532-35978554 TTGTATCTGCTGGTTCCATGGGG - Intergenic
1066991300 10:42516721-42516743 ATGTGTCTGCTGGCACCAAGAGG - Intergenic
1067941697 10:50661868-50661890 ATGTGTCTCCTAAAGCCAAGAGG - Intergenic
1068164336 10:53308644-53308666 ATCTTTGTGCTGTATCCATGAGG + Intergenic
1072297881 10:94029002-94029024 ATGTGACTGCTGAATCCAGGAGG + Intronic
1072541526 10:96401932-96401954 AGGTGACTGCTGAACCCAAGGGG - Intronic
1075859481 10:125662255-125662277 ATGTGTCTGCTCACTCACTGAGG - Intronic
1075878213 10:125825209-125825231 CTGTTCCTGCTGAAGCCATGTGG + Intronic
1077045735 11:544500-544522 AGGGGTCTGCTGATTCTATGGGG - Intronic
1078064244 11:8067560-8067582 ATTTGTCGGGTGAATACATGAGG - Intronic
1078752920 11:14182006-14182028 ATGTGACAGCTCTATCCATGAGG + Intronic
1078998585 11:16729804-16729826 ATGGGTCTCCTGAATACAGGTGG - Intronic
1079314050 11:19392539-19392561 ATGTGGTTGCTGGATCCAGGAGG + Intronic
1079483761 11:20912007-20912029 ATGTGGTTGTTGAATCCATGAGG - Intronic
1080207572 11:29748186-29748208 AATTTTCTGCTGAATCCAAGTGG + Intergenic
1081900391 11:46622632-46622654 TGGTGTCTGCTGAATCAAAGGGG + Intronic
1084868039 11:72075901-72075923 ATCTGTCTTCTGAACCTATGAGG - Intronic
1085687446 11:78636666-78636688 ATGTGTATGCTGCAGCCATTGGG - Intergenic
1086452674 11:86932678-86932700 CTGTGTCTGCTCATTCCAAGTGG - Intronic
1089606152 11:119642544-119642566 AAGTGGCTGCAGAGTCCATGAGG - Intronic
1090913373 11:131141288-131141310 ATGTCATGGCTGAATCCATGAGG + Intergenic
1091252257 11:134153825-134153847 ACTTGGCTGCTGATTCCATGTGG - Intronic
1091634088 12:2184240-2184262 ATGTGTCTTCTGAAGCCACGAGG + Intronic
1092299407 12:7231226-7231248 CTGTGTGTGCTGACTCCATTTGG + Intergenic
1097470718 12:59987574-59987596 ACATTTCTGCTGAATTCATGTGG - Intergenic
1101521618 12:105487542-105487564 ATTTGTCTGCAGATTCAATGGGG + Intergenic
1102074650 12:110050144-110050166 AACTGTTTGCTGAATACATGAGG + Intronic
1102882050 12:116493077-116493099 ATGAGTCAGCAGAAGCCATGAGG + Intergenic
1103541530 12:121669591-121669613 ATGTGTGTTCTGAGTCCCTGGGG + Exonic
1104045678 12:125160807-125160829 ATGTGCCAGCAGATTCCATGAGG - Intergenic
1107064767 13:36201162-36201184 AGGTGTCTCCTGGAGCCATGGGG - Intronic
1109499924 13:63221006-63221028 ATGTGTTGGCTGAATCTATCAGG + Intergenic
1110505137 13:76277311-76277333 ACATATCTGCTGAATCGATGTGG + Intergenic
1110965650 13:81692054-81692076 ATTTGTCTTCTTAATACATGTGG - Intergenic
1114934738 14:27519516-27519538 ATGTGTCTGCAGAAGGCATCTGG + Intergenic
1116737561 14:48712096-48712118 AAGTGTCTGCTCAATCCTTGTGG + Intergenic
1121112628 14:91322604-91322626 GTGTCTCTGCAGAATTCATGGGG + Intronic
1121915781 14:97835961-97835983 ATGTGGCTGCTGAATTCATGTGG - Intergenic
1123049406 14:105533439-105533461 ATGTGTCTGCTGAGGTCCTGTGG + Intergenic
1124213029 15:27779259-27779281 ATGTGTCTGCTAGGTCCATTTGG + Intronic
1124686170 15:31784184-31784206 ATGTGGCTTCAGATTCCATGTGG + Intronic
1125263959 15:37858217-37858239 ATGAGGCTGCTGAATTCATATGG - Intergenic
1125439660 15:39688501-39688523 AGGTTTCTGCTGAATGCATATGG + Intronic
1133198461 16:4187453-4187475 ATGTATCATCTGAATCCATGGGG - Intergenic
1134219465 16:12342365-12342387 ATGTTGCTGATGAAACCATGAGG + Intronic
1134447688 16:14343289-14343311 ATGTGTTTGAGGAATCAATGGGG - Intergenic
1136145128 16:28312047-28312069 ATGTGTGTGCTGTATGCACGTGG + Intronic
1137313953 16:47296924-47296946 ATGTGTCTATTAAATCCATTTGG + Intronic
1138311760 16:56030171-56030193 ATTTCTCAGCTGAAACCATGGGG + Intergenic
1138905737 16:61329804-61329826 ATGTGTCTGTTGTGTCCATTTGG + Intergenic
1139578996 16:67860747-67860769 ATGTGTCTGCTGAAGCCCACAGG - Intronic
1139736737 16:68996575-68996597 ATGTTTCTGCTGAGGGCATGTGG + Intronic
1140973338 16:80035197-80035219 ATGTGTCTGATGAAATAATGTGG + Intergenic
1141982143 16:87557194-87557216 TTGTGCCTGCTGAGTCCCTGGGG - Intergenic
1144614318 17:16754724-16754746 AAGTGTCTGCTAGGTCCATGTGG + Intronic
1144678061 17:17174465-17174487 AAGTGTCAGCTCAATCCCTGGGG - Intronic
1144683779 17:17213063-17213085 ATGTGTGTTCTGAAGCCATGGGG - Exonic
1144898389 17:18560953-18560975 AAGTGTCTGCTAGGTCCATGTGG - Intergenic
1145133986 17:20384768-20384790 AAGTGTCTGCTAGGTCCATGTGG + Intergenic
1145257446 17:21334414-21334436 ATGTGCCAGCAGACTCCATGTGG - Intergenic
1145319196 17:21753621-21753643 ATGTGCCAGCAGACTCCATGTGG + Intergenic
1149373343 17:56018657-56018679 ATGTAACTGCTGAAGCCAAGTGG - Intergenic
1150170047 17:62984949-62984971 AAGTGTCTGTTAAATCCATTTGG + Intergenic
1151647192 17:75441353-75441375 ATGTGACAGCTGACTCCACGAGG + Intronic
1153962394 18:10150578-10150600 TTCTGTGTGCTGCATCCATGTGG + Intergenic
1153962398 18:10150642-10150664 ATGTGTGTGCAGCATCCACGTGG + Intergenic
1153962400 18:10150674-10150696 ATGTGTGTGCAGCATCCACGTGG + Intergenic
1153962403 18:10150734-10150756 TTCTGTGTGCTGCATCCATGTGG + Intergenic
1153962406 18:10150766-10150788 CTGTGTGTGCTGCATCCACGTGG + Intergenic
1153962408 18:10150798-10150820 CTGTGTGTGCTGCATCCACGTGG + Intergenic
1153962412 18:10150862-10150884 CTGCGTGTGCTGCATCCATGTGG + Intergenic
1153962414 18:10150892-10150914 TTCTGTGTGCTGCATCCATGTGG + Intergenic
1153962416 18:10150924-10150946 CTGTGTGTGCTGCATCCACGTGG + Intergenic
1153962420 18:10150988-10151010 CTGCGTGTGCTGCATCCATGTGG + Intergenic
1153962422 18:10151018-10151040 TTCTGTGTGCTGCATCCATGTGG + Intergenic
1156117510 18:33803815-33803837 ATGTGTCTCCTGAGTTCATCTGG - Intergenic
1156134793 18:34024821-34024843 ATGTATCTGTAGGATCCATGTGG + Intronic
1157030012 18:43894420-43894442 ATGTGTCTTTTGAATTAATGTGG - Intergenic
1160278409 18:77461920-77461942 CTCTCTCTGCTGAAGCCATGAGG + Intergenic
1160376945 18:78420795-78420817 ATGTGGATGATGGATCCATGGGG - Intergenic
1161563237 19:4985401-4985423 AGGTCTCTGCTCCATCCATGTGG + Intronic
1165602647 19:37069686-37069708 ACGTTTCTACTGAATCCATATGG + Intronic
1166176755 19:41078600-41078622 AAGTGTCTGTTGAGTCCATTGGG + Intergenic
1166399425 19:42467272-42467294 ATGTGTCTGGTGCATGCGTGTGG + Intergenic
1168464557 19:56591077-56591099 ATGTGTCTGTTTTTTCCATGTGG - Intergenic
928843895 2:35645234-35645256 ATATGTGTGCTGAATCCTTATGG + Intergenic
929305116 2:40352831-40352853 ATATGTCTGTTGCATCCAGGTGG + Intronic
929792546 2:45034301-45034323 ATGTGTTTTCTGAATCCACGTGG + Intergenic
930498926 2:52185768-52185790 ACCTGTGTCCTGAATCCATGGGG - Intergenic
931512258 2:63012837-63012859 ATTTATCTGCTAAATCCTTGTGG - Intronic
935985593 2:108669983-108670005 ATGTGCTTTCTGAATCCATAAGG - Intronic
936138021 2:109913613-109913635 ATGTGCTTTCTGAATCCATAAGG - Intergenic
936206676 2:110457872-110457894 ATGTGCTTTCTGAATCCATAAGG + Intronic
938378593 2:130824150-130824172 AGGTGTTTGCTGAATCCAAGAGG - Intergenic
940897673 2:159096261-159096283 ATGTGTTATCTGAATACATGAGG + Intronic
942663093 2:178287286-178287308 ATGTGTCTGATGTATCTAGGGGG - Intronic
944663469 2:201940073-201940095 CTGTCTCTGCTGTATCCCTGGGG + Intergenic
945902275 2:215552200-215552222 ATGCGTCCTCTGTATCCATGGGG - Intergenic
946555837 2:220856136-220856158 CTGTGTCTGCTGAGTCCAGAAGG + Intergenic
947972452 2:234335673-234335695 ATCTGTTTGCTGAAGACATGGGG + Intergenic
948478291 2:238235232-238235254 ATTTTTTTGCTCAATCCATGGGG + Intergenic
948831816 2:240601999-240602021 ATATCTCTGCTGCATCCTTGGGG - Intronic
1169235093 20:3924442-3924464 GTGTCTCTGCTGCCTCCATGCGG - Intronic
1170047766 20:12104476-12104498 ATATGTCTGCTGGATCCATTTGG - Intergenic
1170768709 20:19313698-19313720 ATCTGGCTGCTGATTCCATGTGG + Intronic
1174278896 20:49424145-49424167 CTGTGTGTGCAGAATCCATTTGG + Intronic
1174470752 20:50758898-50758920 ATGTGGCTGCTGCATACTTGAGG + Intergenic
1174574629 20:51527609-51527631 ATGTGTTGGCTGAATGAATGAGG + Intronic
1177283561 21:19018370-19018392 ATGTATCTCCTGAAGACATGAGG + Intergenic
1177717630 21:24859970-24859992 ATTTGTCTGATGAATACATAAGG + Intergenic
1177752983 21:25308893-25308915 ATTTGGGTCCTGAATCCATGGGG - Intergenic
1179364683 21:40746748-40746770 ATGTGTATTCTGAATCTATTGGG - Intronic
1182724896 22:32436751-32436773 CTGTGTCTGCTGAGTACCTGGGG + Intronic
1183179025 22:36246051-36246073 AGGTGGCTGGAGAATCCATGTGG + Intergenic
1184311404 22:43646656-43646678 ATGTAGATGCTTAATCCATGTGG - Intronic
949976398 3:9464606-9464628 ATGTGACTGGTGAAAACATGAGG - Exonic
950625965 3:14247033-14247055 ATATGTTTGCTGAATGAATGAGG - Intergenic
951734976 3:25853184-25853206 ATGTATCTGCTGTATCTATGTGG + Intergenic
960519809 3:118641712-118641734 ATGTGTCTGCTTCCTGCATGCGG + Intergenic
962878738 3:139556097-139556119 CTGTCTCTGCTTCATCCATGGGG - Intergenic
967484738 3:190016975-190016997 ATGAGTCCACTGAATCAATGTGG + Intronic
967566866 3:190983309-190983331 ATGTGGCTGCTTAATCCGTCTGG - Intergenic
968446978 4:657130-657152 ATGTGTGTGCGGTATGCATGCGG + Intronic
971595881 4:28527825-28527847 ATATTTCTGTTGAAACCATGAGG - Intergenic
973144600 4:46809749-46809771 ATATGTCTGCTAAGTCCATTTGG + Intronic
973793572 4:54400797-54400819 ATTTCTCTGCTGACTCCATTAGG + Intergenic
975810677 4:78165852-78165874 ATGTGTCTGCTCACTCTTTGGGG - Intronic
976971389 4:91106647-91106669 ATGTGTCAGGTGCATCCATTTGG + Intronic
980338938 4:131516282-131516304 ATGTGTCTGCTGCATCCCCATGG + Intergenic
981929458 4:150174129-150174151 CTGTGTGTGGTGAGTCCATGAGG - Intronic
982208970 4:153019773-153019795 CTGTGTTTACTGAATGCATGTGG + Intergenic
983428546 4:167619236-167619258 ATATGTCTGTTGGATCCATTTGG + Intergenic
986227475 5:5828984-5829006 GAGTGTCTGCTGAATGCATATGG - Intergenic
986477722 5:8152886-8152908 ATGAGGCTGCTGGAGCCATGAGG + Intergenic
987116906 5:14732902-14732924 ATGTGTCTGTTGATTTAATGAGG - Intronic
987185052 5:15408920-15408942 ATGTTTCTGCAATATCCATGTGG - Intergenic
987249382 5:16082790-16082812 ATGTGTCTGCATAAATCATGGGG - Intronic
994679616 5:102869310-102869332 TAGGGTCTGCTGAATTCATGAGG + Intronic
996450296 5:123614006-123614028 ATGTGACTGTTGAAGCCATTAGG - Intronic
999909162 5:156178167-156178189 CTGTTTCTACTGAATGCATGTGG + Intronic
1000773791 5:165391068-165391090 AAATGTCTGCTCAGTCCATGTGG - Intergenic
1001270802 5:170310142-170310164 TTGTGTTTGCTGCATGCATGAGG + Intergenic
1002477505 5:179476454-179476476 AAATGTCTGCTGAATCAATTTGG - Intergenic
1002477664 5:179477586-179477608 AAATGTCTGCTGAATCAATTTGG + Intergenic
1002535992 5:179875861-179875883 AGGTGCCTGCTGGTTCCATGAGG - Intronic
1002581870 5:180213848-180213870 ATGTGTGTGCTGTGTGCATGTGG + Intergenic
1003215885 6:4111186-4111208 ATGTGTCTGCTGGGTCCAGTGGG + Intronic
1003819500 6:9880097-9880119 ATATGTCTGCTAGATCCATTTGG - Intronic
1006922251 6:37634662-37634684 ATGTGTCTGCTGAAATGCTGAGG - Exonic
1007831437 6:44641806-44641828 ATGTTTCTGCTGGATCCCTTTGG + Intergenic
1007991263 6:46258620-46258642 AGGTGTGTGATGAGTCCATGAGG - Intronic
1008489568 6:52072047-52072069 GTGTGTGTGTTGTATCCATGTGG + Intronic
1008764848 6:54899384-54899406 ATGTGTATTGTGAATCCATATGG - Intronic
1010940083 6:81906530-81906552 AGGTGTGTGTTCAATCCATGAGG + Intergenic
1011726156 6:90212486-90212508 GTGTGTTTGCTGCCTCCATGTGG - Intronic
1013352537 6:109318602-109318624 CTGTGTTTGCTGCATCCAGGCGG + Intergenic
1014248199 6:119089870-119089892 ATGAGTTTTCTGAATTCATGGGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014853844 6:126375048-126375070 AAATGTCTGCTGAATGAATGAGG - Intergenic
1016462748 6:144295401-144295423 GTGTGTCAGCTGGCTCCATGTGG + Intronic
1016604918 6:145909306-145909328 ATGTGTATGCTGTGTCTATGAGG + Intronic
1018402271 6:163435734-163435756 ATGTTTCTGCTGTATATATGAGG + Intronic
1018603958 6:165577714-165577736 CTGTGGCTGCTGATTGCATGAGG - Intronic
1018920610 6:168169833-168169855 ATTTTTCTGCAGAATCCCTGGGG + Intergenic
1019837319 7:3401091-3401113 ATGTATCTTCTAAATCCATCAGG - Intronic
1021630718 7:22643858-22643880 ATATGTCTGTTGATTCCATTTGG + Intergenic
1023881539 7:44324183-44324205 AAGTGTCTGGTGAAACCTTGTGG - Intronic
1024318113 7:48040211-48040233 ATGGGCCTGGTGAAGCCATGAGG - Intronic
1024679190 7:51666150-51666172 AAGTGTCTGGTGAATCACTGTGG + Intergenic
1026555433 7:71404701-71404723 ATGTGGCTCCTGTATCCCTGAGG + Intronic
1030892023 7:115010102-115010124 ATGGGTCCTCTGCATCCATGTGG - Intronic
1031475590 7:122217144-122217166 GTGTGACTGATGAATGCATGAGG - Intergenic
1034152452 7:148927651-148927673 TTGTTTCTGGTGAATCCAAGTGG - Intergenic
1035320274 7:158024623-158024645 ATGTGGCTCCTGACCCCATGGGG + Intronic
1036006585 8:4671555-4671577 AAGTGTCTGGTGAATTCACGTGG - Intronic
1036223910 8:6942695-6942717 ATGTTTGTTCTGAATGCATGAGG + Intergenic
1036610467 8:10345473-10345495 ATGTGTGTGCTGAAGTCAGGTGG - Intronic
1036817765 8:11914633-11914655 ATGTGGCTCCTATATCCATGGGG + Intergenic
1038967183 8:32587656-32587678 AAGTGTCTGCTGAAAGGATGAGG - Intronic
1042630182 8:70807493-70807515 ATTGGTGTGCTGAATCCAGGAGG + Intergenic
1043375328 8:79642351-79642373 ATGTGTCTGTTCCAACCATGTGG + Intronic
1044605255 8:94042356-94042378 GTGTGTCTCCTGATTCCATATGG - Intergenic
1047765551 8:127987083-127987105 ATGTGTCTCCTGATTTCTTGGGG + Intergenic
1049047426 8:140164084-140164106 CTGTGTTTGCTGAGTACATGTGG - Intronic
1053309232 9:37005347-37005369 AAGTGTCTGCTAAGTCCCTGCGG - Intronic
1056231723 9:84552634-84552656 CTGTGTCTTCTGATTTCATGTGG + Intergenic
1059459239 9:114419449-114419471 ATGTGACTGCTGACTGCTTGAGG - Intronic
1188090654 X:25960773-25960795 ATGTGTCTGGTGAATACACAGGG + Intergenic
1188380500 X:29485921-29485943 ATGTGCCTACAGATTCCATGGGG - Intronic
1189970051 X:46408985-46409007 AGGTGTCTGCTGCCCCCATGTGG + Intergenic
1190992310 X:55565263-55565285 ATGTGTCTGGTGTCTCCGTGAGG + Intergenic
1191652365 X:63553529-63553551 ATGTGTGTGGTGTATGCATGGGG - Intergenic
1192441113 X:71174542-71174564 TTGTTTTTCCTGAATCCATGTGG - Intergenic
1192503131 X:71666056-71666078 ATGTGTCTGCTGGCTTCCTGTGG + Intergenic
1192529460 X:71872575-71872597 ATGTGTCTGCTGGCTTCTTGGGG + Intergenic
1193087926 X:77463964-77463986 CTGTGTCTGCTTATTTCATGTGG + Intergenic
1194751034 X:97684208-97684230 ATGGGTCAGCTGAACCCATTTGG - Intergenic
1195144831 X:102002727-102002749 AGGTGTCTGTTAAATCCATTTGG - Intergenic
1195964048 X:110414086-110414108 GTCTTTCTGCTGCATCCATGAGG + Intronic