ID: 1064172878

View in Genome Browser
Species Human (GRCh38)
Location 10:13049741-13049763
Sequence AGGCTGCCCAGAAGAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064172876_1064172878 -9 Left 1064172876 10:13049727-13049749 CCAGGTCACAGAGAAGGCTGCCC 0: 1
1: 0
2: 2
3: 21
4: 231
Right 1064172878 10:13049741-13049763 AGGCTGCCCAGAAGAGCCCTGGG 0: 1
1: 0
2: 2
3: 43
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064172878 Original CRISPR AGGCTGCCCAGAAGAGCCCT GGG Intronic
900399993 1:2469107-2469129 AACGTGCCCAGGAGAGCCCTGGG - Intronic
900495747 1:2975269-2975291 AGGCTGCCCACAAAACCCCAGGG + Intergenic
901323156 1:8351457-8351479 AGGCTGGCCACAGGAGCCCCAGG - Intergenic
901390601 1:8943540-8943562 GGGCTTCCCAGGAGAGCTCTGGG - Intergenic
901529753 1:9845487-9845509 AGGCTGCCCCGAAGCTCCCTGGG - Intergenic
902389241 1:16093060-16093082 AGGAGGCCCAGAGGACCCCTAGG + Intergenic
903577953 1:24350868-24350890 TGTCTGCTCAGAAGATCCCTTGG + Intronic
903865244 1:26392955-26392977 AGGCTGCCCAGAAGAGCTAGTGG - Intergenic
904612430 1:31732845-31732867 GGGCTGCCCAGATGGGGCCTGGG + Intronic
904747485 1:32720088-32720110 AAGCTGCCCAAGAAAGCCCTTGG + Intergenic
905863669 1:41365770-41365792 AGGCTTCCCAGAGGAGTCCAGGG - Intronic
907426722 1:54384382-54384404 AGACTGCACAGAGGGGCCCTGGG + Intronic
907520140 1:55018515-55018537 AGGCTGGCCAGCGGAGGCCTGGG - Intergenic
909474855 1:76071504-76071526 AGGAAGCCAAGAAGAGCCCTAGG + Intergenic
910812713 1:91254167-91254189 AGGCTGCCCACCACAGCTCTGGG - Intergenic
913123758 1:115766220-115766242 AGGCTACCCAGAAGCCCCTTGGG + Intronic
914922952 1:151859900-151859922 ACTCTGCCCAGAGGAACCCTGGG + Intergenic
915063132 1:153203210-153203232 AGGCTGCAGTGAAGAGTCCTGGG - Intergenic
916600784 1:166291467-166291489 AGATAGCCCAGAAGAGCCCCAGG + Intergenic
917300542 1:173569999-173570021 AAGCTGGCTTGAAGAGCCCTTGG - Intronic
917734623 1:177909141-177909163 ACACTGCCCAGCAGAGCACTTGG + Intergenic
918015853 1:180632049-180632071 GGGCTGCTCTGAAGAGACCTCGG + Exonic
920148822 1:203886876-203886898 AGTGTGCCCAGAATAGCCCAGGG + Intergenic
920193114 1:204207473-204207495 TTGCTGCCAAGAAGAGCCCATGG + Intronic
921348062 1:214207431-214207453 AGGGAGCCAAGAAGATCCCTAGG - Intergenic
1063101571 10:2954499-2954521 GGGCCACCCAGTAGAGCCCTGGG - Intergenic
1063130682 10:3173917-3173939 GGGGTTCCCAGAAGGGCCCTTGG - Intergenic
1064172878 10:13049741-13049763 AGGCTGCCCAGAAGAGCCCTGGG + Intronic
1064347618 10:14547126-14547148 AGTGTACCCAGAAGAACCCTGGG - Intronic
1065941012 10:30563958-30563980 AGGCTGCCCAGCAGAGCATGCGG - Intergenic
1066130705 10:32390680-32390702 AGGATGCCTGGAAGAGCCCTAGG + Intergenic
1067126330 10:43518711-43518733 AAGATGCATAGAAGAGCCCTGGG - Intergenic
1067748973 10:48957563-48957585 GGGCTACACAGAAGAGCCCCTGG - Intronic
1068596793 10:58910727-58910749 ATGCTGCCAAGAAGAGCCTATGG - Intergenic
1069633101 10:69909497-69909519 AGGGTGCCCAGACCAGCCATGGG - Intronic
1069878217 10:71576072-71576094 GGGCTGCCCAGAGGCCCCCTGGG - Intronic
1070544914 10:77444760-77444782 AGGCTGCCCAGCTGCTCCCTGGG - Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1072316324 10:94206729-94206751 ATGCTGCTCTGAGGAGCCCTAGG + Intronic
1072660311 10:97359930-97359952 AGGCTTCCCACAGGAGCCCCTGG + Intronic
1073042524 10:100617374-100617396 AGGGTTCCCAGAAGACCCTTTGG + Intergenic
1073491649 10:103856370-103856392 AGGGTCCCCAGGGGAGCCCTGGG - Intergenic
1076561967 10:131372913-131372935 AGGCTGCCCAGGATTGCCCGGGG - Intergenic
1077242638 11:1518582-1518604 TGGCTGTGCAGACGAGCCCTAGG - Intergenic
1077326757 11:1967323-1967345 GGGCTGCCCTGAAGAGCTGTTGG - Intronic
1077538865 11:3137260-3137282 AGGCTGCCCACATTAGCACTAGG - Intronic
1077754538 11:5012171-5012193 AAGTTGCTCAGAAGAGCTCTGGG + Intergenic
1079229067 11:18634112-18634134 CGGCTGCCCAGAAGTTCCATGGG + Intronic
1080100280 11:28451868-28451890 AGGTAGCCCAGGAGAGCTCTTGG + Intergenic
1080691977 11:34565907-34565929 AGGCTGGCCAGATGAGTGCTGGG + Intergenic
1081283448 11:41239592-41239614 AGGGTGACCAGGACAGCCCTTGG - Intronic
1083208988 11:61170933-61170955 AAGCATCCCAGAAGAGCCCTCGG + Intergenic
1083227861 11:61295707-61295729 TGGGTGCCCAGAGGAGCCCGGGG - Intergenic
1083396381 11:62395448-62395470 GGGCTGCAGAGAAGAGTCCTGGG + Intergenic
1083783151 11:64928438-64928460 TGCCTGCCCAGCAGAGACCTGGG + Intronic
1084172009 11:67405364-67405386 AGGCTGCCTAGTGGAGCCCTTGG + Intronic
1084407043 11:68980109-68980131 AGGCTGCCCACCAGGTCCCTGGG - Exonic
1084900131 11:72303429-72303451 AGGGTGGCAAGAAGAACCCTGGG + Intronic
1085260923 11:75204230-75204252 AGGCTCTGCAGAGGAGCCCTGGG - Intronic
1089146973 11:116336286-116336308 TTCCTTCCCAGAAGAGCCCTGGG - Intergenic
1089221699 11:116877283-116877305 AGGCTGACCAGAAAAGGTCTGGG + Intronic
1089813869 11:121154904-121154926 AGGATGCAAAGAAAAGCCCTTGG + Intronic
1091103137 11:132894481-132894503 CTGCTGCTCAGAAGAGCTCTAGG - Intronic
1091297294 11:134482963-134482985 AGGCTGCCCAGAGGGGCTCAAGG + Intergenic
1202809738 11_KI270721v1_random:22503-22525 GGGCTGCCCTGAAGAGCTGTTGG - Intergenic
1091373665 12:12888-12910 CGCCAGCCCAGCAGAGCCCTAGG - Intergenic
1091974205 12:4811474-4811496 AGGCTGCCCACAAGTGACGTGGG - Exonic
1092043048 12:5402565-5402587 AGGCTGCCCAACAGAGCTTTAGG + Intergenic
1092441354 12:8508133-8508155 AGGCTGCTCAGCACAGCTCTGGG + Intergenic
1093690135 12:22101294-22101316 AGGCTGTCCACCAGAGCTCTGGG + Intronic
1095351680 12:41221155-41221177 GGGCTACCCAGGAGAGCTCTTGG + Intronic
1096399327 12:51291966-51291988 AGGCTGCCCTGAAGGGCTCAGGG + Exonic
1096532189 12:52249127-52249149 AGGAAGCCCAGAAGAGCCACGGG + Intronic
1103426000 12:120834445-120834467 AGACTGCCCAGAAGAGAGATAGG + Intronic
1104492531 12:129207494-129207516 ACGCTGCTCAGAAAAGGCCTTGG + Intronic
1106383495 13:29263174-29263196 AGCCTGTCCAGAAGAGCTCAAGG + Intronic
1108212923 13:48156674-48156696 AGCATGCCCACATGAGCCCTGGG + Intergenic
1108729539 13:53220140-53220162 AGGCTGCCAACCAGAGCCTTGGG - Intergenic
1111338141 13:86848077-86848099 AGTCTGCCCACCACAGCCCTGGG - Intergenic
1112251372 13:97783741-97783763 AGGATGCCCTGAAGAGCCTTTGG + Intergenic
1112971381 13:105267067-105267089 TGGGTGCCCAGAGGAGCCCTGGG - Intergenic
1113725949 13:112601865-112601887 AGAGAGCCCAGAAGAGTCCTGGG + Intergenic
1114549783 14:23526053-23526075 ACGCAGCCAAGAAGAGCCCAAGG - Exonic
1117881240 14:60315583-60315605 AGGCTGCCCTGAGCAGCCTTGGG + Intergenic
1118395695 14:65334569-65334591 AGTCTGCGCAGAAGAGTCCCAGG - Intergenic
1118675534 14:68180821-68180843 TTCCTGCCCAGAAAAGCCCTTGG - Intronic
1119167150 14:72503904-72503926 GGGCTGCCCAGAAGAGCTGCAGG - Intronic
1119225600 14:72942611-72942633 CGGCTGCCGGGAAGAGCCCCAGG - Intronic
1120746056 14:88152992-88153014 AGGCTGCCAAGAGGAGGCCTGGG + Intergenic
1121630157 14:95416140-95416162 GTGCTGCCAAGGAGAGCCCTTGG - Intronic
1121710725 14:96037892-96037914 AGCCTGCCCAGAACTGCCCAGGG - Intergenic
1121731796 14:96192574-96192596 AGGCTGCCCAGAGCTGCCCCCGG - Intergenic
1122327564 14:100891607-100891629 ACTCTGCCCAGAATAACCCTGGG + Intergenic
1123030473 14:105449034-105449056 AGGCTGTCCAGATGAGACCGGGG - Intronic
1123192401 14:106583724-106583746 AGGCTGCACAGGAGAGCCTCAGG + Intergenic
1123798471 15:23797657-23797679 AGCCTGCCCAGAAGAGGCTTTGG - Intergenic
1124373787 15:29117826-29117848 AGGGTGCCCAGAAGAGACGACGG - Exonic
1124985003 15:34599736-34599758 AGGTTCCTCAGAAGGGCCCTTGG - Intergenic
1125227664 15:37413176-37413198 AGCCTGTCCAGGACAGCCCTGGG + Intergenic
1127474879 15:59323831-59323853 TGGCTGCCCATAAGAGCCCCTGG + Intronic
1129268626 15:74408147-74408169 GGGGGACCCAGAAGAGCCCTGGG - Intergenic
1129524988 15:76208163-76208185 AGGCTGCTCACCAGAGGCCTTGG + Intronic
1129928570 15:79387989-79388011 AGACTGCCCAGAAGTACCGTAGG - Intronic
1130689278 15:86066574-86066596 AGCCTGACCTGAGGAGCCCTTGG + Intergenic
1131180405 15:90235203-90235225 ATGCTGCCAAGGAGAGCACTGGG - Intronic
1132068343 15:98752036-98752058 AGTCTGCACAGAGGAACCCTAGG - Intronic
1132453964 16:12442-12464 CGCCGGCCCAGTAGAGCCCTAGG - Intergenic
1132806654 16:1778097-1778119 AGGTTCCCCAGAAGCACCCTGGG + Intronic
1133091857 16:3411035-3411057 AGCCTTCCCTGAGGAGCCCTAGG + Intronic
1133225827 16:4339959-4339981 TGGCTGCCGACAAGAGCTCTGGG + Intronic
1133574475 16:7075325-7075347 AGGTTGCCCAAAAGAACTCTAGG + Intronic
1136183316 16:28569989-28570011 AGGATGCCCTGAAGAGCCTTGGG + Intronic
1136348920 16:29694731-29694753 AGGCTGCGTAGTTGAGCCCTGGG - Exonic
1137963580 16:52909608-52909630 TGGCTGACCAAAAGAGCACTAGG + Intergenic
1138199294 16:55077220-55077242 TGGCTACCCAGAACAGGCCTAGG - Intergenic
1138349625 16:56339592-56339614 AGCCAGGCCAGGAGAGCCCTGGG + Intronic
1139514660 16:67446095-67446117 AGGCTGTCCAGAGAAGACCTTGG + Intronic
1139676638 16:68528493-68528515 AGGCAGGCCAGAAGGGACCTTGG + Intergenic
1140349816 16:74251583-74251605 ATGTAGCCCAGAAGAGCACTTGG + Intergenic
1140975310 16:80054371-80054393 GGGCTGCCAAAAAGAGCCTTTGG - Intergenic
1141745948 16:85926360-85926382 AGGCAACCCAGAACAGCGCTTGG + Intergenic
1141838884 16:86561307-86561329 AGGCTGCCGAGCAGATGCCTGGG + Intergenic
1143865258 17:9918615-9918637 AGGCTGCTCAGCAGAGGCCCAGG - Intronic
1144959675 17:19038168-19038190 AGGCTGCTCAGTACAGACCTCGG + Intronic
1144975485 17:19136356-19136378 AGGCTGCTCAGTACAGACCTCGG - Intronic
1146275784 17:31514737-31514759 AGGGAGACCAGAAGAGACCTGGG - Intronic
1147155101 17:38540652-38540674 AGGCTGCTGTGAAGGGCCCTGGG + Intronic
1148902460 17:50888488-50888510 AGCCTGGGCAGAGGAGCCCTGGG + Intergenic
1151401946 17:73861445-73861467 AGTCTGCCCGGAGGAGACCTGGG - Intergenic
1151551330 17:74824148-74824170 AGGCTGCCCAGAGCAAACCTGGG - Intronic
1151726728 17:75889473-75889495 AAGCTGCCACGAAGACCCCTGGG - Exonic
1152297742 17:79478106-79478128 AGGCTGCCCGCATGAGCCGTGGG - Intronic
1153674368 18:7443062-7443084 AGGCACCCCTGAAGAGCCTTGGG + Intergenic
1155366819 18:25057187-25057209 AGGCTTCCCAGAGCAGCTCTGGG - Intergenic
1157617431 18:48995479-48995501 AGGTTTCCAAGAAGGGCCCTTGG - Intergenic
1158676258 18:59521529-59521551 AGACTCCACAGAAGAGGCCTTGG - Intronic
1160513078 18:79463359-79463381 AGGGTGCTCAGAAGGGTCCTGGG + Intronic
1160730630 19:640235-640257 AGGCTGCACAGAGGAGCCTCCGG - Intronic
1160835184 19:1121647-1121669 AGCCTGCCGACGAGAGCCCTGGG + Intronic
1160855425 19:1215113-1215135 AGGCTGCTCAGGAGAGCTCGGGG - Intronic
1160937997 19:1606415-1606437 AGGCTGGGCAGAAGAACCCACGG - Intergenic
1161358376 19:3832254-3832276 TGGCTGCTCAGATGGGCCCTGGG - Intronic
1162463901 19:10829708-10829730 GGGCTGCCTTGCAGAGCCCTGGG + Intronic
1162943845 19:14030850-14030872 CGGCTGCCCCGAAGAACCCCAGG - Exonic
1163364472 19:16868442-16868464 GGGCTGCCCAGCAGAGGCCCTGG + Intronic
1164618884 19:29682136-29682158 GGGCTGCCCAGAAGTGCCCGAGG + Intergenic
1165342746 19:35224451-35224473 AGGCTCCCCAGATCTGCCCTGGG - Intergenic
1165369943 19:35398757-35398779 AGGCAGCCCAGGAAGGCCCTCGG - Intergenic
1165859579 19:38900225-38900247 AGGCTGCCAAACGGAGCCCTAGG + Intronic
1166765983 19:45252166-45252188 GGGCTGCCCACAGGCGCCCTGGG - Intronic
1167036350 19:46997360-46997382 AGGCTGCCCGGGAGAGCTCCTGG + Intronic
1167593778 19:50417351-50417373 AGGATGCTCAGGAGAGGCCTTGG - Intronic
1167807593 19:51799325-51799347 AGGCTGCCCGAAAGCGACCTGGG + Intronic
925203928 2:1990904-1990926 AGGCTGCACAGCAGATTCCTGGG - Intronic
929628707 2:43435955-43435977 AGCCTGGCCAAAAGAGCCCTAGG + Intronic
930030528 2:47055790-47055812 AGTCTGCCCAGGAGACACCTGGG - Intronic
930034352 2:47076241-47076263 AGACGGCCAAGAACAGCCCTGGG - Intronic
930088664 2:47516388-47516410 AAGCTGCCCAGGAGGTCCCTTGG + Intronic
932604383 2:73155543-73155565 AGGGTTTCCAGAAGAGCTCTAGG - Intronic
935266927 2:101402870-101402892 AGCTTACCCAGAAGAGGCCTGGG + Intronic
935337984 2:102034729-102034751 AGGGTGCCCAGAGAAGCACTAGG + Intergenic
935618889 2:105111947-105111969 GGACTGCCCAGGAGGGCCCTGGG - Intergenic
936151481 2:110024434-110024456 AGGCTCCCCAGGTGAGGCCTGGG + Intergenic
936193193 2:110346935-110346957 AGGCTCCCCAGGTGAGGCCTGGG - Intergenic
936522500 2:113220052-113220074 ATCCTGCCCAGCAGAGGCCTGGG + Intronic
937619924 2:123973551-123973573 TCGTTGCTCAGAAGAGCCCTTGG - Intergenic
939497356 2:142939887-142939909 GGGCTGCCCAGATTAGCCCTGGG - Intronic
940331768 2:152482908-152482930 AGACTGCCTACAAGAGGCCTAGG - Intronic
940340025 2:152570527-152570549 AGGCTGGCAAGAAGAGCCTTTGG - Intronic
941089657 2:161160288-161160310 GGGCGGGGCAGAAGAGCCCTGGG + Exonic
941336338 2:164248351-164248373 AGGCAGACCACAAGAGACCTAGG - Intergenic
943846549 2:192656152-192656174 GGCATGCCCAGAAAAGCCCTGGG + Intergenic
947152601 2:227130572-227130594 GGGCAGCCCTGAAGAGCTCTGGG - Intronic
948423086 2:237872430-237872452 AGGCTTCCCAGGAGAGGCTTCGG - Intronic
948447027 2:238040767-238040789 ACCCTGCCCAGAAGAGAGCTGGG - Intronic
948456791 2:238108247-238108269 AGTCTTCTCAGAACAGCCCTTGG + Intronic
948901194 2:240957702-240957724 GGGCTGCCCAGAGGAGCTCCTGG + Intronic
1170759866 20:19239830-19239852 AGGCTGCCCACAGGGCCCCTGGG - Intronic
1172005827 20:31818755-31818777 AGGCTGCCCTGAGTAGCCATGGG - Intergenic
1172225793 20:33304424-33304446 GGGCTGATCAAAAGAGCCCTGGG - Intronic
1173119883 20:40278992-40279014 AAGCTGCCCAGATGATCCCAGGG + Intergenic
1174127411 20:48317237-48317259 AGGCAGACCAGCAGGGCCCTCGG + Intergenic
1174306258 20:49616158-49616180 AGGCTGCCCATCAGAGCCCCAGG + Intergenic
1174486403 20:50864044-50864066 AGGCGCCACAGATGAGCCCTGGG - Intronic
1175141058 20:56860350-56860372 AGGCTGCCCAGAGGAGACTGGGG + Intergenic
1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG + Intergenic
1175852350 20:62100318-62100340 AGGCTGCCCATGAGAGCCCCTGG - Intergenic
1176105257 20:63382730-63382752 CAGCTGCCCAGAATAGCGCTGGG + Intergenic
1176275564 20:64265471-64265493 ACACTGCCCAGAACAGACCTTGG - Intronic
1176307955 21:5134103-5134125 TGGCCGCCCAGCAGCGCCCTGGG + Exonic
1176970220 21:15256261-15256283 AGGCTGACCTGAAGAACACTTGG - Intergenic
1177856487 21:26405954-26405976 ACTCTGCTGAGAAGAGCCCTTGG - Intergenic
1178271422 21:31193407-31193429 AGCCTCCCCAGAAAAGCCCTGGG + Intronic
1178978221 21:37238997-37239019 GCGCTGCCCAGAAGAGCACGGGG - Intronic
1179849106 21:44127927-44127949 TGGCCGCCCAGCAGCGCCCTGGG - Exonic
1179960802 21:44766177-44766199 AGGCTGCCCAGCAGGCCCCTGGG + Intergenic
1180082711 21:45494022-45494044 CAGCCGCCCAGAAAAGCCCTCGG + Intronic
1181582067 22:23834057-23834079 TGGCTGCCCTGTAGAGCCTTGGG + Intronic
1181736355 22:24884696-24884718 AGGCTGCCCTGAAGGGCCCTGGG - Intronic
1182284194 22:29234327-29234349 CCGCTGCCCAGCAGAGCCTTGGG - Exonic
1182367637 22:29789554-29789576 AGGCTGCCAGGCAAAGCCCTAGG - Intronic
1182519010 22:30874851-30874873 CGGCTGCCCAAGAGAGGCCTTGG - Intronic
1182708796 22:32307467-32307489 ATGGTTCCCAGAAGGGCCCTGGG + Intergenic
1183265761 22:36824168-36824190 GTGCTGCCCAGAGGAACCCTGGG + Intergenic
1183304223 22:37073572-37073594 AGGCTGCCCATCACAGACCTTGG + Exonic
1183518497 22:38282340-38282362 AGGCTGCCCAGGTGTGACCTTGG - Intergenic
1183585551 22:38751051-38751073 TGGAGGCCCAGAAGAGCCCCTGG - Intronic
1184116649 22:42426397-42426419 AGGGTGCCGAGAAGAGCCAGAGG - Intronic
949323479 3:2838362-2838384 AGGGTGACCAGAAGAGCCCTTGG - Intronic
949387639 3:3521154-3521176 AGGCTTCCCAGAAGACACCCAGG - Intergenic
949651566 3:6166031-6166053 AAGCTGCCCAGAGGCTCCCTAGG - Intergenic
949873738 3:8610624-8610646 AAGGTGACCAGTAGAGCCCTGGG - Intergenic
950440207 3:13006150-13006172 GGGCTACCCAGGAGAGGCCTGGG - Intronic
950600931 3:14035135-14035157 AGGCTGCCCACCACAGCTCTGGG + Intronic
950884198 3:16348538-16348560 CTGCTGACCAGAAGTGCCCTGGG - Intronic
950952394 3:17014164-17014186 AGTCTGCCCAGCAGGGACCTTGG - Intronic
951453844 3:22868596-22868618 AGGATTCCAAGAAGAGCCCTTGG + Intergenic
952420369 3:33125130-33125152 ATGCTGCCCAGTAAAGCACTTGG - Intronic
952964315 3:38611627-38611649 AGGCTGGGTGGAAGAGCCCTTGG + Intronic
953043703 3:39277329-39277351 ACTCTGCCCAGAAGAGCCAGGGG - Intronic
953145477 3:40270812-40270834 AGGATGCCCTGAAGAGCCAAGGG - Intergenic
953184940 3:40629205-40629227 AGGCTGCACAGAGCAGCCCTGGG - Intergenic
953985924 3:47442921-47442943 AGGATGCACAGAGGAGCCCATGG + Exonic
954363223 3:50133337-50133359 AAGATCCCCAGATGAGCCCTGGG - Intergenic
964475297 3:157092429-157092451 GGGCTGCCGAGGAGACCCCTGGG + Intergenic
965810951 3:172591678-172591700 AGGCTGCCCACCACAGCTCTGGG + Intergenic
968544595 4:1192304-1192326 GGGCTGCCAAGACCAGCCCTAGG - Intronic
968739378 4:2319648-2319670 AGGCCACCCAGCAAAGCCCTTGG + Intronic
968916165 4:3497883-3497905 AGGCTGCCCAGGAGGACCCTTGG - Intronic
969025436 4:4168731-4168753 AGGTTTCCCAGCAGAGACCTAGG - Intergenic
970135711 4:12920974-12920996 AGGTGGCCAAGAAGAGACCTGGG - Intergenic
972427268 4:38945305-38945327 AGGCTGCACAGAAGACCCTGCGG + Exonic
975212140 4:71713163-71713185 AGACTGCACAGAACAGCCATGGG - Intergenic
975576912 4:75872268-75872290 AGGATTCCCAGATGAGCACTAGG - Intronic
981646774 4:147007428-147007450 TGGATTCCCAGAAGAGCCTTGGG - Intergenic
985638500 5:1052176-1052198 AGGCTGAACAGGAGAGCCCTAGG + Exonic
985988874 5:3538898-3538920 AGGCTGCCCAGCAGGGGCCCAGG + Intergenic
986035427 5:3932551-3932573 ATGCTGCCCAGAATTACCCTGGG - Intergenic
987299035 5:16580699-16580721 AGGCTGCCCAGAAGACCATGAGG + Intronic
987321946 5:16778502-16778524 GGGATGCCCAGACAAGCCCTGGG - Intronic
992349118 5:75911291-75911313 AGGCTGCCCTGAAGGGCTCAGGG - Intergenic
994386728 5:99142001-99142023 ACTGTGCCCAGCAGAGCCCTGGG + Intergenic
996269483 5:121585474-121585496 GGGCTGCCCACGGGAGCCCTAGG - Intergenic
996716394 5:126591410-126591432 AGCCTGTCCAACAGAGCCCTGGG - Intronic
998057380 5:139090001-139090023 ATGCTACCCAGAAGAGGTCTAGG - Intronic
998155862 5:139786843-139786865 AGGCAGTGCAGAAGAGCACTGGG + Intergenic
999251412 5:150184363-150184385 AGGCTGCCCATCAGGGCCCAGGG + Exonic
1001022437 5:168194954-168194976 CGGGTGCCCAGGAGACCCCTGGG + Intronic
1001127899 5:169037041-169037063 CCTCTGCTCAGAAGAGCCCTTGG - Intronic
1001758113 5:174186283-174186305 AGGCTGCCCCGAGGACCCCCCGG + Intronic
1002386890 5:178875192-178875214 AGGCTGCCCACCATAGCTCTGGG + Intronic
1008487947 6:52055605-52055627 CGGCTGCCCAGAAGGGCTATCGG - Exonic
1008489247 6:52068247-52068269 AGACAGCCATGAAGAGCCCTGGG - Intronic
1009769490 6:68126885-68126907 AGGCTGCCCACTGGAGCTCTGGG + Intergenic
1014609948 6:123530034-123530056 AGGCTGTGCAGGAGAGCCGTGGG + Intronic
1016751309 6:147633353-147633375 CCGCAGCCCAAAAGAGCCCTCGG - Intronic
1017236109 6:152119053-152119075 AGGCAGCCCAGACCAGCCCTGGG + Intronic
1017317764 6:153052171-153052193 TGCCTGCCCAGCAGAACCCTGGG + Intronic
1017528581 6:155265181-155265203 AGGCTGCCCAGCCGGGCCATGGG + Intronic
1018369751 6:163156732-163156754 AGGCTTTCCAGCAGAGCCCCAGG - Intronic
1018707895 6:166476205-166476227 AGGCTGGCCAGCAAAGCCCCGGG + Intronic
1020281471 7:6652394-6652416 AGGCCGCCGACCAGAGCCCTGGG - Exonic
1022555943 7:31296163-31296185 AGAGTCCCCAGAAGATCCCTGGG + Intergenic
1026256472 7:68716422-68716444 TGGGTGGCCAGAAGAGCTCTAGG + Intergenic
1028980453 7:96962387-96962409 AGGGAGCCCAGAAGATCCTTTGG - Intergenic
1030374899 7:108744276-108744298 AGGCTGCCCACCATAGCTCTGGG + Intergenic
1030984241 7:116222350-116222372 AGGCTGCCCAGAGGAGCAGGAGG - Intronic
1032428692 7:131843047-131843069 AGGCAGCCTAGAAGGGCCCTGGG - Intergenic
1032749646 7:134825843-134825865 AGACTGACCAGAGGAGCCCTGGG + Intronic
1034553505 7:151835772-151835794 AGGCTGCCCACGAGAGCCCCCGG - Intronic
1034717217 7:153254755-153254777 AGAATGCCCAGATGAGCTCTTGG - Intergenic
1034781821 7:153888065-153888087 CGTTTCCCCAGAAGAGCCCTGGG - Intronic
1034967927 7:155403008-155403030 TGGATGCCCAGAAGACCACTAGG + Intergenic
1035016310 7:155769444-155769466 AGGCTGCTGAGGAGAGCCCTCGG + Intronic
1035469859 7:159102830-159102852 AGGCTGCTCTAAGGAGCCCTGGG - Intronic
1036444640 8:8810926-8810948 AGGCCTCCCTGAAGAGTCCTGGG + Intronic
1036685973 8:10910588-10910610 CAGCTGCTCAGAAGAGCCCAGGG - Intronic
1038017895 8:23530068-23530090 AGCCTGCCCAGAACACCCCAGGG + Intronic
1038489881 8:27963185-27963207 TGACTGCCTAGAAGAGCCATAGG + Intronic
1039195847 8:35030630-35030652 AGGTTCCCCAGAAAATCCCTTGG - Intergenic
1040286185 8:46101604-46101626 AGCCTGCCCTGGAGAGCCCTGGG + Intergenic
1040288349 8:46111777-46111799 AGCCTGCTCAGGACAGCCCTGGG + Intergenic
1040288901 8:46114336-46114358 AGCCCGCCCAGGACAGCCCTGGG + Intergenic
1040289504 8:46117134-46117156 ATCCTGCCCAGAACAGCCCTGGG + Intergenic
1040289890 8:46118864-46118886 AGCCTGCTCAGGAGAGCCCTGGG + Intergenic
1040290267 8:46120596-46120618 AGCCTGCCCAAAATAGCTCTGGG + Intergenic
1040292269 8:46131594-46131616 AGCCTGCCCAGGACAACCCTGGG + Intergenic
1040293091 8:46135500-46135522 AGCCTGCCCAGGACACCCCTGGG + Intergenic
1040294673 8:46143015-46143037 AGCCTGCCCTGGACAGCCCTGGG + Intergenic
1040294943 8:46144293-46144315 AGTCTGCCCAGGACAGCCCTGGG + Intergenic
1040295141 8:46145147-46145169 AGCTTGCCCAGGACAGCCCTGGG + Intergenic
1040301083 8:46188342-46188364 AGCCCGCCCAGGACAGCCCTGGG + Intergenic
1040302567 8:46195579-46195601 AGTCTGCCCAGGACAGCCTTGGG - Intergenic
1040304254 8:46203827-46203849 AGCCTGCCCAGAGTAGCCATGGG - Intergenic
1040304527 8:46205158-46205180 AGTCTGCCCAGCACAGCCTTGGG - Intergenic
1040307036 8:46217451-46217473 AGCCTGCCCAGGACAGTCCTGGG - Intergenic
1040307830 8:46221358-46221380 AGTCTGCCCAGGACAGCCCCGGG - Intergenic
1040312352 8:46243304-46243326 AGCCTGCCCAGCGCAGCCCTGGG - Intergenic
1040312937 8:46246129-46246151 AGCCTGCCCAGGACAGCCCTGGG - Intergenic
1040313559 8:46249266-46249288 AGCATGCCCAGGACAGCCCTGGG - Intergenic
1040314137 8:46252020-46252042 AGCCTGCCCAGGGGAGCCCAGGG - Intergenic
1040315914 8:46260829-46260851 AGCCTGCCCAGAACACCCCTGGG - Intergenic
1040317955 8:46274893-46274915 AGCCTCCCCAGGACAGCCCTAGG - Intergenic
1040324230 8:46333581-46333603 AGCCTGCCCAGGATAGCTCTAGG - Intergenic
1040324997 8:46337177-46337199 AGCCTGCCCAGGAGAGCCGTGGG - Intergenic
1040325377 8:46338912-46338934 AGCCTACCCAGGACAGCCCTGGG - Intergenic
1040325788 8:46340850-46340872 AGCTTGCCCAGGACAGCCCTGGG - Intergenic
1040326405 8:46343868-46343890 AGCCTACCCAGTACAGCCCTGGG - Intergenic
1040328966 8:46376302-46376324 AGCCTGCCCAGGACAGCCCTGGG - Intergenic
1040332261 8:46391646-46391668 AGCCTGCCCAGGACAGCCCTGGG - Intergenic
1040333271 8:46403204-46403226 AGCCTGCCCAGGGCAGCCCTGGG - Intergenic
1040333765 8:46405731-46405753 AGCTTGCCCGGAACAGCCCTGGG - Intergenic
1040337475 8:46423378-46423400 AGCCTGCCCGGGACAGCCCTGGG - Intergenic
1040339909 8:46435241-46435263 AGCCTGCCAGGAACAGCCCTGGG + Intergenic
1040340049 8:46435892-46435914 AGCCTGCCCAGGACAACCCTGGG + Intergenic
1040340616 8:46438685-46438707 AGCCTGCCCGGGACAGCCCTGGG + Intergenic
1040341372 8:46442826-46442848 AGCCTGCCCAGGACAACCCTGGG + Intergenic
1040341554 8:46443667-46443689 AGCCAGCCCAGGACAGCCCTGGG + Intergenic
1040342386 8:46447515-46447537 AGCCTGCCTGGAACAGCCCTAGG + Intergenic
1041649929 8:60292300-60292322 AGACTGCCCAGAAGAACCCCAGG - Intergenic
1042241168 8:66666247-66666269 AGGCATGCCAGAAGAGCTCTCGG + Exonic
1045322472 8:101092346-101092368 AGACTGCCCACCATAGCCCTTGG + Intergenic
1046984197 8:120369420-120369442 AGGCTGGCCAGAAGGACCTTGGG - Exonic
1048472105 8:134712894-134712916 AGGGGGCCCGGAAGAGCCCGAGG - Exonic
1049363475 8:142225269-142225291 AGCCAGACCAGGAGAGCCCTGGG - Intronic
1049475578 8:142795601-142795623 AGGCCTCCCAGCAGCGCCCTCGG - Intergenic
1049603846 8:143520119-143520141 GGGCTGCCCTGCAGAGCTCTGGG - Intronic
1049805149 8:144535433-144535455 AGCCTGCCCAGAGGGGCCCTTGG - Intronic
1049819807 8:144626759-144626781 AAGCTGCCCAGCAGAGCCGCGGG - Intergenic
1049883383 9:12874-12896 CGCCGGCCCAGTAGAGCCCTAGG - Intergenic
1051122744 9:13769594-13769616 AGTTTGCCCAGAAAAGTCCTAGG - Intergenic
1051513913 9:17907633-17907655 AGGCGGCGCGGAAGGGCCCTGGG + Intergenic
1051827351 9:21234605-21234627 AGGCTGCCCACAACAGCTCTGGG - Intronic
1052235006 9:26201867-26201889 AATCTTCACAGAAGAGCCCTAGG - Intergenic
1055640510 9:78315679-78315701 GGGCTGCCCAGAGGGGCCTTAGG - Intronic
1056502481 9:87223520-87223542 ACGTTGCCCAGCAGGGCCCTGGG + Intergenic
1056698194 9:88878581-88878603 AGTGTCCCCAGAAGAGCCCAGGG - Intergenic
1056813489 9:89782511-89782533 AGGCAGCCCAGAGGGGCCCAGGG - Intergenic
1060555937 9:124507209-124507231 AGGCTGGCCATTAGAGGCCTGGG + Intronic
1060971620 9:127741733-127741755 AGACTGTCTGGAAGAGCCCTGGG - Intronic
1061671014 9:132188199-132188221 AGGCTGCCCAGGAGAGGCCCTGG - Intronic
1062020737 9:134318238-134318260 AGCCAGCTCAGAACAGCCCTGGG + Intronic
1062066714 9:134532128-134532150 AGGCTCCCCATAACAGACCTGGG - Intergenic
1062145549 9:134987859-134987881 AGGCTCCCCAGAAAAGACCAAGG + Intergenic
1062613922 9:137387595-137387617 AGGGTGCCTGGGAGAGCCCTGGG + Intronic
1191742365 X:64449306-64449328 AGGCTGCACAGAGCAGCCATGGG + Intergenic
1191803405 X:65105906-65105928 AGTCTGCTGAGAAGAGCTCTTGG + Intergenic
1192067658 X:67903634-67903656 TGGGTGTCCAGAAAAGCCCTTGG + Intergenic
1192172005 X:68861560-68861582 AGTGTGCCAACAAGAGCCCTGGG - Intergenic
1193067719 X:77276782-77276804 AGGCTGCACATCAGAGCCCTGGG - Intergenic
1200402432 X:156027274-156027296 CGCCGGCCCAGTAGAGCCCTAGG + Intergenic