ID: 1064176386

View in Genome Browser
Species Human (GRCh38)
Location 10:13079252-13079274
Sequence CGCGTGCCTCCTCATGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064176386_1064176390 -8 Left 1064176386 10:13079252-13079274 CCTCTCTCATGAGGAGGCACGCG 0: 1
1: 0
2: 4
3: 8
4: 60
Right 1064176390 10:13079267-13079289 GGCACGCGTTGTGGCCTTAGGGG No data
1064176386_1064176388 -10 Left 1064176386 10:13079252-13079274 CCTCTCTCATGAGGAGGCACGCG 0: 1
1: 0
2: 4
3: 8
4: 60
Right 1064176388 10:13079265-13079287 GAGGCACGCGTTGTGGCCTTAGG No data
1064176386_1064176393 14 Left 1064176386 10:13079252-13079274 CCTCTCTCATGAGGAGGCACGCG 0: 1
1: 0
2: 4
3: 8
4: 60
Right 1064176393 10:13079289-13079311 GTAAGGAATCGAGACCCACCTGG No data
1064176386_1064176389 -9 Left 1064176386 10:13079252-13079274 CCTCTCTCATGAGGAGGCACGCG 0: 1
1: 0
2: 4
3: 8
4: 60
Right 1064176389 10:13079266-13079288 AGGCACGCGTTGTGGCCTTAGGG No data
1064176386_1064176391 -3 Left 1064176386 10:13079252-13079274 CCTCTCTCATGAGGAGGCACGCG 0: 1
1: 0
2: 4
3: 8
4: 60
Right 1064176391 10:13079272-13079294 GCGTTGTGGCCTTAGGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064176386 Original CRISPR CGCGTGCCTCCTCATGAGAG AGG (reversed) Intronic
916988269 1:170214853-170214875 CACATGCCTCCTCAGCAGAGTGG + Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920184501 1:204151793-204151815 CGTGTGCCTCCTCAGGTGAAAGG + Exonic
922460869 1:225813467-225813489 CTCCTCCCTCCTCAGGAGAGGGG - Intronic
924735791 1:246754360-246754382 GGCATGCCTCCTCATGGGAGAGG + Intronic
1063943207 10:11151911-11151933 CGCCTGCCTCCTACTCAGAGAGG - Intronic
1064176386 10:13079252-13079274 CGCGTGCCTCCTCATGAGAGAGG - Intronic
1069724301 10:70567417-70567439 CTCTTTCCTCCCCATGAGAGGGG - Exonic
1070149221 10:73795571-73795593 CGTGTGCCTTCACATAAGAGGGG - Exonic
1077398071 11:2336311-2336333 AGAGTGCCCCCTCGTGAGAGAGG - Intergenic
1088909901 11:114183006-114183028 CACAAGCCTCCTCAGGAGAGAGG + Intronic
1091800797 12:3323395-3323417 CGCCTGCATCCTCATCTGAGCGG - Intergenic
1093981737 12:25482773-25482795 CGTGTGCCTCTTCAAGTGAGAGG - Intronic
1096872465 12:54602056-54602078 AGTGTGCACCCTCATGAGAGAGG - Intergenic
1100806725 12:98293091-98293113 CAGGTGCCACCTCATCAGAGAGG + Intergenic
1114009038 14:18347889-18347911 GGTGCGCCTCCTCATGGGAGAGG - Intergenic
1122616412 14:103020957-103020979 CTCGTGATTCCTGATGAGAGGGG - Intronic
1124303704 15:28564032-28564054 CCCGTGCTTCCTCCTGGGAGAGG + Intergenic
1124934958 15:34161368-34161390 GGCGTGCCTCCTCATGGGAGAGG + Intronic
1136670071 16:31848916-31848938 GGGGCCCCTCCTCATGAGAGAGG - Intergenic
1137052106 16:35723122-35723144 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1143914407 17:10278376-10278398 TGCGTGCCTCCTGGTGTGAGGGG - Intergenic
1146106096 17:30038895-30038917 GGGGCGCCTCCTCATGAGAAAGG - Intronic
1148225195 17:45894462-45894484 CGCGAGCCTCCCCAGGGGAGGGG - Exonic
1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG + Exonic
1153922350 18:9803138-9803160 GGCATTCCTCCTCATGGGAGAGG + Intronic
1156651583 18:39233003-39233025 CGCGTGCTCCCTCCTGGGAGAGG - Intergenic
1160515625 18:79477952-79477974 CGCGTGACTCTACTTGAGAGTGG - Intronic
1163976506 19:20858191-20858213 AGCACGCTTCCTCATGAGAGAGG - Intronic
1166652553 19:44585491-44585513 CACATGCATCCTCATTAGAGGGG + Intergenic
933756693 2:85645069-85645091 CACGTGCTTCATCATGTGAGTGG + Exonic
936765955 2:115848690-115848712 CTCTTGCCTCCTCAGGAGAAAGG - Intergenic
937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG + Intronic
937997929 2:127709044-127709066 AGGGTGCCTCCTCATGTAAGAGG + Intronic
940199572 2:151135409-151135431 GGCGTGCCTCGTGGTGAGAGCGG - Intergenic
941996961 2:171610363-171610385 TGTGTGCCTCCTCCTCAGAGAGG + Intergenic
945719883 2:213406828-213406850 GGTGCGCCTCCTCACGAGAGAGG - Intronic
1170026206 20:11891398-11891420 CGCGCGCCTCCCCGGGAGAGGGG - Intronic
1172760610 20:37318612-37318634 CTGGTTCCTCCTCTTGAGAGGGG + Intergenic
1174062498 20:47842783-47842805 TGCGTGCCTGCTCCTGAAAGGGG + Intergenic
1178083718 21:29092315-29092337 CTCTTGCCTCCTCTTTAGAGAGG - Intronic
1180433538 22:15278699-15278721 GGTGCGCCTCCTCATGGGAGAGG - Intergenic
1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG + Intergenic
1183222423 22:36524501-36524523 CTTGTGACTCCTAATGAGAGAGG - Intronic
1183631800 22:39037857-39037879 CCCGTACATCCTCATCAGAGGGG - Intergenic
949675360 3:6447425-6447447 CGCATGCTTCCTCCTGTGAGGGG - Intergenic
950595077 3:13972739-13972761 GGCATGTCTCCTCATGGGAGAGG + Intronic
961081712 3:124033544-124033566 CGCGCGCCTCCGCCTGAGGGAGG + Intergenic
963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG + Intergenic
973887608 4:55339125-55339147 GGCATGGCGCCTCATGAGAGAGG - Intergenic
982445247 4:155483427-155483449 CTCTTGCATCCTCATGTGAGAGG + Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
999553901 5:152720488-152720510 AACGTGTCTCCTCATGAGAGGGG - Intergenic
1001548795 5:172587236-172587258 CGAGTTCCACCTCCTGAGAGTGG - Intergenic
1002056098 5:176598680-176598702 ACCCTGCCTCCTCAGGAGAGGGG - Exonic
1002428092 5:179187556-179187578 TGGGGGCCTCCCCATGAGAGGGG - Intronic
1003246197 6:4384379-4384401 GATGTGCCTCCTCATGGGAGAGG - Intergenic
1017902484 6:158730524-158730546 GGGGCGCCTCCTCATGAGAGAGG - Intronic
1018017619 6:159726899-159726921 CAGGTGCCACCTCAAGAGAGAGG - Exonic
1018137011 6:160788752-160788774 AGCATGCTCCCTCATGAGAGAGG - Intergenic
1019623505 7:2003772-2003794 CACCTGCCTCCTGATGACAGTGG - Intronic
1023798112 7:43810710-43810732 GGCGCGCCTCCTCATGAGAGAGG - Intergenic
1027382647 7:77627252-77627274 CGCTTGCCTCTTGATGAGAAAGG + Exonic
1033044136 7:137945793-137945815 CACCCGCCTCCTCATGAGGGTGG + Intronic
1034494028 7:151409706-151409728 CGCGTGCCTCCGCAGGAGTCGGG - Intronic
1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG + Intronic
1038472968 8:27840717-27840739 CCCCTGCCTCCTCCTGAGACGGG - Intergenic
1040621192 8:49095099-49095121 AGGGCACCTCCTCATGAGAGAGG - Intergenic
1042568274 8:70134607-70134629 TGCCTGCCTCCTCCTGACAGTGG - Intronic
1049461738 8:142732813-142732835 AGCGTGCTCCCTCATGAGAGAGG + Intronic
1050059095 9:1687095-1687117 CGTGTGCCTCCTCTTGTGAGGGG - Intergenic
1202088619 Y:21164704-21164726 GACATGCCTCTTCATGAGAGGGG + Intergenic