ID: 1064183838

View in Genome Browser
Species Human (GRCh38)
Location 10:13143043-13143065
Sequence CAGGGGGTAGGGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064183838_1064183847 15 Left 1064183838 10:13143043-13143065 CCATCTTCCTTCCCTACCCCCTG No data
Right 1064183847 10:13143081-13143103 TTCTTGAAGTCTTGTTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064183838 Original CRISPR CAGGGGGTAGGGAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr