ID: 1064186718

View in Genome Browser
Species Human (GRCh38)
Location 10:13168192-13168214
Sequence GAGAATGTCACATGCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064186718_1064186726 28 Left 1064186718 10:13168192-13168214 CCTTGCAGGCATGTGACATTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1064186726 10:13168243-13168265 TCTCTTGCACTGTGCAGCCTTGG No data
1064186718_1064186722 -10 Left 1064186718 10:13168192-13168214 CCTTGCAGGCATGTGACATTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1064186722 10:13168205-13168227 TGACATTCTCAGAGCACAGGGGG No data
1064186718_1064186723 -2 Left 1064186718 10:13168192-13168214 CCTTGCAGGCATGTGACATTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1064186723 10:13168213-13168235 TCAGAGCACAGGGGGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064186718 Original CRISPR GAGAATGTCACATGCCTGCA AGG (reversed) Intronic
903227298 1:21901046-21901068 GGGGATGTCACATGCCGGCTGGG + Intronic
905026247 1:34851887-34851909 AAGAGGGTCACATGCCTCCAAGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
908176895 1:61565048-61565070 CAGCATGTCACATGCAAGCAAGG + Intergenic
908776523 1:67646290-67646312 GAGCCTCTAACATGCCTGCAAGG + Intergenic
909291051 1:73884047-73884069 GACAATGCCACATGCTGGCAAGG + Intergenic
909420718 1:75461953-75461975 GAGAAAATCACAATCCTGCAGGG + Intronic
911972111 1:104452128-104452150 GAGCATGTCACAGGTCTTCATGG + Intergenic
915002361 1:152604845-152604867 CAGAAGGCCACATGGCTGCAGGG + Intergenic
915079508 1:153342094-153342116 GAGCCTGACACATGCCTGGAGGG - Intronic
916846687 1:168658309-168658331 CAGACTGTCACATGCTTGAATGG + Intergenic
920032666 1:203046572-203046594 GAGACTGTCACATCCCTGCAGGG - Intronic
924629288 1:245721739-245721761 GAGAAGGACACATGCCTGGTTGG + Intergenic
1063941217 10:11131626-11131648 GAGCATGTCACCTTCCTCCATGG - Intronic
1064186718 10:13168192-13168214 GAGAATGTCACATGCCTGCAAGG - Intronic
1069710145 10:70482800-70482822 GAGAATGTCACAAGGATGAAAGG + Intronic
1070657169 10:78279553-78279575 GAGAGAGTCATTTGCCTGCATGG - Intergenic
1071269458 10:83993498-83993520 GAGAAGGTCACCTTCCTGGAGGG - Intergenic
1072231448 10:93417417-93417439 GATAATGACACTTGCCTACATGG + Intronic
1072715888 10:97752347-97752369 CAGAAAGTCAAATGCCTGCATGG - Intronic
1073260609 10:102187373-102187395 GAGAACATCACATACCTGCCAGG - Intergenic
1073765004 10:106672547-106672569 GAGAATGTCATATGGTTGCATGG - Intronic
1076581915 10:131517531-131517553 AAGAATGGCTCATGCCTACACGG - Intergenic
1077746535 11:4913400-4913422 GAGAATGTCATGTTCCTGCATGG - Intronic
1079721282 11:23817242-23817264 GGGAATGTCACAGGTCTTCACGG - Intergenic
1081394380 11:42568115-42568137 CAGAATTTCAAATGCCTACATGG - Intergenic
1085277899 11:75311845-75311867 GAGGGTGTCACAGGCCAGCAGGG - Intronic
1085356532 11:75843127-75843149 GAGAATTTTAGATGCATGCAAGG + Intronic
1085534716 11:77211117-77211139 GAGCAGGTCACAGGCGTGCAGGG - Intronic
1085635697 11:78157933-78157955 ATGAAGGGCACATGCCTGCACGG + Intergenic
1085829756 11:79886746-79886768 CAGTATGTCACATTCCTGAAAGG - Intergenic
1086328997 11:85734322-85734344 GAGAATCTCACATGCTTTAATGG + Exonic
1087030326 11:93697424-93697446 GAGAATATCACAGCCCAGCAAGG + Exonic
1087639145 11:100736529-100736551 GACAGTGTCACATCCCTGCAGGG + Intronic
1088169303 11:106977666-106977688 GAGAAACTCAGATGCCTCCAGGG + Intronic
1088216859 11:107520085-107520107 GAGGTTGTCACATTCCTCCAAGG + Intronic
1090087981 11:123667934-123667956 GAGAATGTTCCATGTCAGCAGGG + Intergenic
1090233730 11:125129868-125129890 GAGAATGTTAGAGGCTTGCACGG - Intergenic
1091122858 11:133071026-133071048 GAGAATGTGATCTCCCTGCAGGG + Intronic
1094399037 12:30041333-30041355 GAGAATGTAAGTTGCCTCCAAGG + Intergenic
1095461530 12:42449424-42449446 GAGATGGTAAAATGCCTGCATGG - Intronic
1096263031 12:50104707-50104729 GAGAATGTCAAATACCTGCCAGG + Exonic
1098107223 12:67081868-67081890 CAGAATATCCCACGCCTGCATGG - Intergenic
1098189006 12:67927814-67927836 GAAAAAGTCACGTTCCTGCAAGG - Intergenic
1104060352 12:125262832-125262854 CAGAAAGTCAAATGCCTGCAGGG - Intronic
1104285785 12:127423378-127423400 TAGAATGTCAAATGTCTGCTTGG - Intergenic
1104803061 12:131567937-131567959 CTGAATGTCACTTGACTGCATGG - Intergenic
1109100550 13:58179521-58179543 AAGAATGAAACATGCCTTCAAGG - Intergenic
1110760299 13:79223679-79223701 TAGAATGTAAGATGCCTGCAGGG - Intergenic
1111575884 13:90153780-90153802 AACAATATCACATCCCTGCAGGG - Intergenic
1111989597 13:95103557-95103579 GTGAATGACACATGCCTGAGGGG + Intronic
1113205876 13:107915330-107915352 GGGTAAGTCACATGCCAGCAGGG + Intergenic
1114535665 14:23420747-23420769 GAAAAGGTCACAGGCCTGGAGGG - Intronic
1115059577 14:29172881-29172903 GACAATATCACATCCCTGGAGGG + Intergenic
1120082155 14:80228548-80228570 GACAATATCACATCCCTGGAGGG - Intronic
1120821380 14:88914771-88914793 AAGAATGTCACCTGCCCCCAAGG - Intergenic
1121236851 14:92398025-92398047 GAGAAGGTCACATGTGCGCAGGG - Intronic
1121639005 14:95472872-95472894 GAGGATGTCCCATGCCTTCCCGG - Intronic
1124193349 15:27599221-27599243 GAGAGGGTCACGTGCCTGCCCGG + Intergenic
1128324288 15:66713718-66713740 GAGAAGGTCACACTCCTGAAGGG - Intronic
1128549861 15:68591097-68591119 CAGAAGGACACATGGCTGCAGGG + Intronic
1130089158 15:80804967-80804989 GAGCAAGTCACATGGCTGCACGG + Intronic
1130313677 15:82776386-82776408 GAGAATGTTACATGTGTGCTTGG + Intronic
1132085767 15:98907210-98907232 GAAAATGTCACAGGGCTGCTTGG + Intronic
1133416239 16:5609342-5609364 GAGAATGTAAGATGGCTGGATGG - Intergenic
1133673543 16:8047672-8047694 AAGAATGTCACCTGGCTGCCAGG + Intergenic
1135607560 16:23836804-23836826 AAGGATGTCCCATGCCCGCAGGG - Intronic
1141599402 16:85116085-85116107 GACAGTGTCAGATGCCAGCACGG - Intergenic
1143055087 17:4156515-4156537 GAGAAGCTCACAGGCCAGCAGGG + Intronic
1144244223 17:13347058-13347080 GAGAATGTCTCATGACTAAAAGG + Intergenic
1145881446 17:28355711-28355733 GATTAGGTCACAGGCCTGCATGG - Intronic
1151203188 17:72484061-72484083 GCGAATGTCTGCTGCCTGCAAGG + Intergenic
1151711099 17:75807179-75807201 AAGAGTGACACATGCCTGCCTGG - Intronic
1153131410 18:1858733-1858755 AACAATGTCACATCCCTGGAGGG - Intergenic
1153244197 18:3057533-3057555 GAGAATGTCTGAAGCCTCCATGG + Intergenic
1153421968 18:4916879-4916901 GGGAATGTCAGATACCTTCATGG - Intergenic
1153472180 18:5459041-5459063 GAGAATATCACCCTCCTGCAAGG - Intronic
1156285778 18:35694417-35694439 GAGAATGACACATGTTGGCAAGG + Intronic
1160014390 18:75129210-75129232 GTCCATGTCACATCCCTGCATGG + Intergenic
1161936703 19:7376635-7376657 GGGGCTGTCACATTCCTGCAGGG - Exonic
1162085772 19:8248288-8248310 GAGAATATCTCTTGCCTGGATGG + Intronic
1163505226 19:17701813-17701835 GTGAGTGTGAAATGCCTGCAAGG + Intergenic
1163821832 19:19500391-19500413 GACAATGTCAGAGGACTGCAGGG - Intronic
1164183220 19:22837932-22837954 CATAATCTCACCTGCCTGCATGG + Intergenic
1164225726 19:23244164-23244186 CATAATCTCACGTGCCTGCATGG - Intronic
1165817395 19:38650397-38650419 GAGAATGACACATGGCAGCAAGG - Intronic
1167477927 19:49711703-49711725 GAGTTTGCCACATCCCTGCAAGG - Intronic
929269953 2:39961782-39961804 AACAATGTCACATCCCTGGAGGG - Intergenic
930579716 2:53195445-53195467 GAGAATGTCACAGGCCTTGCAGG - Intergenic
930710938 2:54550524-54550546 TAGAATGGCACATGTCAGCAGGG + Intronic
932935731 2:76098781-76098803 GAGCATGTCATAGGCCTTCATGG - Intergenic
933819195 2:86094448-86094470 TGGAATGTCACATGCCAGAAAGG - Intronic
934951791 2:98580622-98580644 CAGAATGGCACATTCCAGCAGGG + Intronic
935307752 2:101754155-101754177 GTGAATGTGAAATGCCTTCAAGG + Intronic
935419796 2:102854906-102854928 GAAAATGCCTCATGCCTCCAGGG - Intergenic
935839581 2:107094670-107094692 GAGAATGCCAGATGGCAGCAGGG - Intergenic
936437559 2:112521509-112521531 GAGAAAGTCCCGTACCTGCAAGG + Intronic
937292659 2:120790879-120790901 GAAAAGATCACCTGCCTGCAGGG - Intronic
937576626 2:123430345-123430367 TCAAATGTCATATGCCTGCAGGG + Intergenic
938193313 2:129301978-129302000 GAGAATCTCACATGCATTAATGG + Intergenic
940701473 2:157049387-157049409 GAGAATGTTACATGCTTGGAAGG + Intergenic
941199954 2:162496075-162496097 AAGAATGGCACATCCATGCATGG - Intronic
943823165 2:192353987-192354009 AAGAATGTCACCTACCTACATGG - Intergenic
945642045 2:212442817-212442839 GACAATATCACATCCCTGGAAGG + Intronic
945972821 2:216246867-216246889 GAGAATGTCATAGGCATGGAAGG - Intergenic
946312740 2:218892004-218892026 GAGAAGGTCTCAGGCCTCCAAGG - Intronic
947658781 2:231851023-231851045 GAGAATGATACATGCTTCCAAGG - Intergenic
1169173809 20:3490333-3490355 GAGAATGTGACCTTCCTGGATGG - Intronic
1175078672 20:56398664-56398686 GACAATGACACATTCATGCATGG - Intronic
1176926513 21:14756550-14756572 GAGAATGTTTCATGCATGCTTGG - Intergenic
1177705957 21:24705218-24705240 GAGGATGCCACATGCATGCAGGG + Intergenic
1178221784 21:30668947-30668969 GAGCATGTCAAAGGCCTTCACGG + Intergenic
1178998960 21:37436382-37436404 GGGAATGACACAAGCCTGCCTGG - Intronic
1179256659 21:39722332-39722354 GAGAAGGTCATGTGCCTGGAAGG - Intergenic
1179519195 21:41931292-41931314 GAAAATGCCACAGCCCTGCAGGG + Intronic
1182307946 22:29384122-29384144 TACAATGTTACATGCCTGAAGGG + Intronic
1183570580 22:38650353-38650375 GCACATGTCCCATGCCTGCATGG + Intronic
1184288646 22:43486511-43486533 GAAAATGTCACACCCCTGCTTGG + Intronic
1185016770 22:48347886-48347908 GAGAATGTTGCATTCATGCAGGG - Intergenic
949735969 3:7172045-7172067 GACAATTTCAAATGCCAGCATGG - Intronic
949751564 3:7357973-7357995 CATAATGTCACATGCCTGCAGGG - Intronic
951234528 3:20218888-20218910 GGGACTGTCACAGGCCTACATGG + Intergenic
951287518 3:20832851-20832873 TAGATTGGCACATGCCTCCAGGG + Intergenic
953030471 3:39176593-39176615 GAGAATGTCACCTATCTGCCCGG - Intergenic
953472768 3:43181018-43181040 AAGAATCGCACATGCTTGCATGG - Intergenic
953651337 3:44807735-44807757 GAGTTTGTCCCATGTCTGCAGGG + Intronic
955201273 3:56854349-56854371 GAGAAAGACACAAGCATGCAGGG + Intronic
955862820 3:63350618-63350640 GTGTAAGTCAAATGCCTGCAGGG + Intronic
957630575 3:82711480-82711502 GAGCATGTCACAGGTCTTCATGG - Intergenic
959536841 3:107496463-107496485 GGGTATGACACATGCCTTCATGG + Intergenic
960243202 3:115370322-115370344 TAAAATGTCACAGGCCAGCATGG - Intergenic
960349398 3:116574682-116574704 AACAATATCACATCCCTGCAGGG + Intronic
961968062 3:130926661-130926683 AGGAATGTCACATGTATGCAGGG + Intronic
962586833 3:136850254-136850276 CAGAATGTCAATTGCCTACAAGG + Intronic
962961674 3:140316758-140316780 TAGAATATCACTTGCCTCCAAGG - Intronic
964991883 3:162824024-162824046 TAAAATTTCACTTGCCTGCATGG + Intergenic
965672125 3:171157893-171157915 GAGAATGTGACATCCCTCTATGG - Intronic
966267463 3:178063493-178063515 GAGAATGGCACATGGCTTCAAGG + Intergenic
967596895 3:191336308-191336330 GAAAATATCAAATGCCAGCAAGG - Intronic
968767115 4:2478408-2478430 GGGCATGTCACAGGCCTTCATGG + Intronic
969055761 4:4401694-4401716 GAGAATGTCCCCTGGCTGCCTGG + Intronic
975662353 4:76700285-76700307 CAGAAAGTCACCTGCCTTCAAGG + Intronic
977990867 4:103440339-103440361 GAATATGTCAGATGACTGCAAGG - Intergenic
981167340 4:141576882-141576904 CAGAAAGTCACATTCATGCAAGG + Intergenic
985579421 5:689133-689155 GAGTATGTGACATGCCTTCCTGG - Intronic
985594267 5:781192-781214 GAGTATGTGACATGCCTTCCTGG - Intergenic
985669455 5:1200190-1200212 GAGAAAGTCCCATGCCTGCCGGG + Intergenic
989333394 5:40286840-40286862 GGGAAAGTCAGATGGCTGCAGGG - Intergenic
991176408 5:63692252-63692274 GAAAATATCATATGCCGGCAAGG + Intergenic
991697789 5:69289100-69289122 GACCCTGTCACCTGCCTGCAAGG - Intronic
993482267 5:88438392-88438414 GTGCATGTCACCTTCCTGCAAGG - Intergenic
993691350 5:91004782-91004804 GAGGATGTCATATGCCATCATGG + Intronic
994153816 5:96479765-96479787 GATAATGTCCCTTGCCTCCATGG + Intergenic
994705222 5:103195769-103195791 GAGAATTTCATATACCTCCAAGG + Intronic
995192446 5:109331887-109331909 GAGACTGTCCCAGGCCTGAAAGG - Intergenic
998160916 5:139812579-139812601 CAGAATCTTACATGCCTGGAAGG + Intronic
1000728553 5:164802152-164802174 GAGCATGTCACAGACCTTCACGG - Intergenic
1002924641 6:1598248-1598270 GAGAGGCTCAGATGCCTGCAGGG - Intergenic
1005888323 6:30114378-30114400 CATAATGTCAAATGCCTTCAAGG - Intergenic
1007889249 6:45271266-45271288 GGGAATGTCAGAGGCCTTCACGG + Intronic
1011218170 6:85027674-85027696 GAGAATTCCACATGTCTGTAAGG - Intergenic
1011963098 6:93116236-93116258 GAAAATGTCATTTGCCTGGAAGG - Intergenic
1012125941 6:95428357-95428379 GAGTATGTCACAGACCTTCATGG + Intergenic
1012478262 6:99637878-99637900 GAGCATGTCACAGACCTTCATGG - Intergenic
1018789457 6:167135502-167135524 GAGATTCTCACATGCCCACAGGG + Intronic
1020122543 7:5513307-5513329 GGGAATGTCCCAGGGCTGCAGGG + Intronic
1021258055 7:18419009-18419031 GACAATGGCACATGTCTGAATGG + Intronic
1024619695 7:51146931-51146953 GAGAATGTCACACCCCTCCTGGG - Intronic
1026476969 7:70744649-70744671 GAATATGTCACCTGTCTGCATGG - Intronic
1028702316 7:93794143-93794165 CAGAATGTCATATGGCTGGAAGG + Intronic
1029847488 7:103427786-103427808 GTGATTGTGACATGCCAGCAAGG - Intronic
1030529575 7:110696134-110696156 GGGCATGTCACATGCATGAAGGG + Intronic
1034293461 7:149950284-149950306 GTGTATTTCACAAGCCTGCAGGG + Intergenic
1034397500 7:150838365-150838387 CTGAGTGTCACCTGCCTGCAAGG + Intronic
1034812604 7:154146569-154146591 GTGTATTTCACAAGCCTGCAGGG - Intronic
1038060612 8:23908044-23908066 GAAAATGTCACATGGAGGCATGG + Intergenic
1038097759 8:24334644-24334666 TAGGATCTCACATGCTTGCATGG + Intronic
1039248121 8:35632003-35632025 GACAATGTCAGATGCATGCACGG - Intronic
1039275011 8:35925720-35925742 GAGACTGGCACATGGCTGCCTGG + Intergenic
1041804951 8:61839776-61839798 GAGAATACCACATGCTGGCAAGG - Intergenic
1043856692 8:85273207-85273229 GACAATGCCAAATGCTTGCAGGG - Intronic
1044518237 8:93165714-93165736 GAGAATGTAACATGGAGGCATGG - Intronic
1049355999 8:142188375-142188397 GCACATGGCACATGCCTGCATGG + Intergenic
1050196966 9:3095745-3095767 AAGAAGGTCTCATGCCTGAACGG - Intergenic
1050729215 9:8688872-8688894 GATAAAGTCATAGGCCTGCAAGG - Intronic
1052266828 9:26583803-26583825 TAAAATGTCACATGTCTCCATGG + Intergenic
1057223376 9:93270032-93270054 GAGCATCTCCCATTCCTGCAGGG + Intronic
1058447867 9:105069726-105069748 GAGAAAGCCAGATGGCTGCATGG - Intergenic
1060211981 9:121716178-121716200 GAGAGGGTCACAGGCCTCCAAGG + Intronic
1060213046 9:121722178-121722200 GGGGAGGTCACATGCATGCATGG - Intronic
1060240872 9:121901796-121901818 GGGATTGTCAGATGCTTGCACGG + Intronic
1060765465 9:126292403-126292425 GAGCATGTTACATTCCGGCAGGG - Intergenic
1060923286 9:127437750-127437772 GAGAATGCCACATGCTGACAGGG - Intronic
1061781449 9:132998896-132998918 TAAAAAGTCACCTGCCTGCAAGG - Intergenic
1062719836 9:138034220-138034242 GAGATTGTCTCATTCCTGCTGGG + Intronic
1187849233 X:23574956-23574978 GAGAAGGGCACATCCTTGCATGG - Intergenic
1188115779 X:26240538-26240560 GGGAATGTTCCATGCCTTCAGGG - Intergenic
1188473272 X:30563581-30563603 GGGAGTGTCACCTGGCTGCATGG - Intronic
1188996179 X:36888287-36888309 GAGAATGACACAAGCCTGGCTGG + Intergenic
1192953556 X:76044073-76044095 GGGAATATCACATGCCTGTTGGG + Intergenic
1194620952 X:96170817-96170839 CAGAATGTCACATCACAGCATGG - Intergenic
1197113010 X:122798209-122798231 GAGAAGGACACAGGCCTGCCTGG + Intergenic
1199727780 X:150601923-150601945 GAGAATGGCACATGCATGATGGG - Intronic
1200868191 Y:8068006-8068028 CACAATGTCACATGCATGCTGGG - Intergenic