ID: 1064187389

View in Genome Browser
Species Human (GRCh38)
Location 10:13174262-13174284
Sequence GGTGGGGCATGCTACTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064187389_1064187397 14 Left 1064187389 10:13174262-13174284 CCTCTGGAGTAGCATGCCCCACC No data
Right 1064187397 10:13174299-13174321 TTGTATTTTTAGTAGAGACAGGG 0: 62759
1: 158911
2: 184886
3: 115845
4: 74212
1064187389_1064187396 13 Left 1064187389 10:13174262-13174284 CCTCTGGAGTAGCATGCCCCACC No data
Right 1064187396 10:13174298-13174320 GTTGTATTTTTAGTAGAGACAGG 0: 941
1: 166872
2: 211363
3: 127840
4: 69914
1064187389_1064187399 29 Left 1064187389 10:13174262-13174284 CCTCTGGAGTAGCATGCCCCACC No data
Right 1064187399 10:13174314-13174336 AGACAGGGTTTCATCATGATGGG No data
1064187389_1064187398 28 Left 1064187389 10:13174262-13174284 CCTCTGGAGTAGCATGCCCCACC No data
Right 1064187398 10:13174313-13174335 GAGACAGGGTTTCATCATGATGG 0: 8
1: 2165
2: 38663
3: 92563
4: 134930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064187389 Original CRISPR GGTGGGGCATGCTACTCCAG AGG (reversed) Intronic
No off target data available for this crispr