ID: 1064188045

View in Genome Browser
Species Human (GRCh38)
Location 10:13180562-13180584
Sequence ATTTGGGGTTATATTGAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064188039_1064188045 11 Left 1064188039 10:13180528-13180550 CCAGAGAGAAGCTGGAAGAAATA 0: 1
1: 0
2: 4
3: 49
4: 310
Right 1064188045 10:13180562-13180584 ATTTGGGGTTATATTGAAGAAGG 0: 1
1: 0
2: 1
3: 32
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064188045 Original CRISPR ATTTGGGGTTATATTGAAGA AGG Exonic
901389288 1:8933032-8933054 ATTTGGGGGTATAATGAGTAGGG + Intergenic
902690862 1:18109518-18109540 AGTTGGGGTTATTTTTAAGGGGG - Intronic
906114129 1:43344731-43344753 CTTAGGGGTTATAATCAAGAGGG + Intronic
906600324 1:47121671-47121693 ATTTGGTGTCAAATTAAAGAGGG - Intergenic
911767774 1:101699983-101700005 TTCTGAGGTTTTATTGAAGAAGG - Intergenic
913271584 1:117099076-117099098 ATTTGGGGTAAGCTTGAAGTTGG + Intronic
915062948 1:153201698-153201720 ATTTGAGGTTTAATTGAATATGG + Intergenic
915234969 1:154473933-154473955 ACTGAGGCTTATATTGAAGATGG + Intronic
915694667 1:157727301-157727323 TTTTGGGGATATATTAAATATGG - Intergenic
916587159 1:166158644-166158666 GTTTTGGGTTTTAGTGAAGAAGG - Intronic
917948943 1:180008480-180008502 ATTTCTGGCTATATTGAAAATGG + Intronic
919103767 1:193123886-193123908 AGTTGGGGTTATTTAGGAGAAGG + Intronic
919491444 1:198210521-198210543 ATTTGGGATTACATATAAGAAGG - Intronic
919922894 1:202176955-202176977 AATTGGGGTTCTTTTGGAGAGGG + Intergenic
919931498 1:202224191-202224213 ATTTGGGGTTATTGTGAGAATGG + Intronic
920418718 1:205815272-205815294 CTTTGGGGTTATTATGAATAAGG + Intergenic
920531468 1:206705720-206705742 ATTTTGGGTTAAATTCAAGGAGG + Intronic
921027146 1:211295654-211295676 ATTTGGGGTTATTTTGTTGAAGG + Exonic
921304949 1:213786787-213786809 ATTTGGGGAGATATTTTAGAAGG - Intergenic
921472524 1:215566894-215566916 ATTGGGGATTAAATTGAAGAGGG + Intergenic
922509157 1:226149078-226149100 TTTTGGGGTTATATTGGTGTTGG - Intronic
923183019 1:231540984-231541006 ATTTGTGTTTATATTTAACATGG + Intronic
1063453946 10:6170053-6170075 GTTTGTGGTTATTTTGAAGTGGG + Intronic
1064188045 10:13180562-13180584 ATTTGGGGTTATATTGAAGAAGG + Exonic
1065324878 10:24541840-24541862 ATTTGAGGTTACATTGGTGACGG - Intronic
1065619669 10:27568216-27568238 ATGTGTGTTTATATTGATGAGGG + Intergenic
1067754914 10:48998361-48998383 CTTTGGGGCTATATTGAAATGGG + Intergenic
1068768610 10:60795227-60795249 ATTTGGGGTTATATTGTGGAGGG + Intergenic
1069809467 10:71147744-71147766 ACTAGGGGTGATATTGGAGAAGG - Intergenic
1070187523 10:74079557-74079579 ATTTGGGGATATATTTATAAAGG - Intronic
1070332017 10:75424399-75424421 ATCTGTGGTTTTCTTGAAGAGGG - Intergenic
1072642376 10:97221621-97221643 ATGTGAGGTTACAGTGAAGACGG + Intronic
1073886513 10:108045610-108045632 ATTTGGATTCATATTTAAGAGGG - Intergenic
1074366786 10:112864285-112864307 AATTGAGGTTCTATGGAAGACGG - Intergenic
1075888147 10:125920171-125920193 ATTTCAGGCTATAGTGAAGAAGG + Intronic
1076838116 10:133031559-133031581 ATTTAGGGTGAGATGGAAGAGGG + Intergenic
1077936985 11:6798511-6798533 AGTGGGAGTTATATTGATGAGGG - Intergenic
1078453641 11:11458449-11458471 ATTTTGGGTTAAAAAGAAGAGGG + Intronic
1080713587 11:34774414-34774436 ATTTGGGGTTCCATTGATTAGGG + Intergenic
1082576538 11:54812487-54812509 ATTTGGGCTTATGGTGAAAAGGG - Intergenic
1085087154 11:73676750-73676772 ATTTGAGGTCAAATTGAAGACGG - Exonic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1085982390 11:81740223-81740245 ATTTGGGGTATTACTGTAGAGGG + Intergenic
1091551204 12:1536194-1536216 TTTTGTGGTGATATTGATGAAGG + Intronic
1092411535 12:8256882-8256904 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
1093577205 12:20746432-20746454 ATTTGGGTTTTTCTCGAAGAAGG - Intronic
1094642945 12:32294161-32294183 ATTTTTTGTTATACTGAAGATGG + Intronic
1095256253 12:40040396-40040418 TTTTGGGGTTGTTTTGAAAAAGG + Intronic
1096221405 12:49830503-49830525 AGTTGGGGTTATGATGAATATGG + Intergenic
1098328125 12:69323722-69323744 ATTTGGGGGTGTAGTGAAGGGGG - Intergenic
1098336885 12:69413528-69413550 ATTTTGGGTTAGATTGACGGGGG - Intergenic
1103175376 12:118858813-118858835 ATTTGTGGTTGTGCTGAAGACGG + Intergenic
1104295696 12:127510614-127510636 ATTTGGTGTATTATTTAAGACGG + Intergenic
1105052677 12:133068561-133068583 ATTTGGGGTTTTTTTTGAGATGG - Intergenic
1106379735 13:29224568-29224590 ATTTGGGGGTATTTTTAAAATGG + Intronic
1106774164 13:32992227-32992249 ATTTGAGGTTATAGTGAACTAGG + Intergenic
1109068083 13:57726418-57726440 ATTTGGGCTTATATTGTAAATGG + Exonic
1109218128 13:59613611-59613633 ATGAGAGGTTATAATGAAGAAGG - Intergenic
1109280951 13:60354652-60354674 TTTGGGGGCTAAATTGAAGAAGG + Intergenic
1111527992 13:89497523-89497545 ATTTGAGTTGATATTGAAAATGG + Intergenic
1111610866 13:90604543-90604565 ATTTGGCTTTATTTGGAAGAGGG - Intergenic
1111977679 13:94983897-94983919 AGTTGGGGGTATATCAAAGAAGG + Intergenic
1114038845 14:18657230-18657252 ATTTGAGGTCAAATTGAAGACGG - Intergenic
1114470990 14:22961590-22961612 GTTTGGGTTTATATTTAAGGAGG + Intronic
1114980129 14:28153163-28153185 TATTGGGGTGACATTGAAGAAGG - Intergenic
1115627365 14:35207384-35207406 ATTTGTAGTAATATTGAAGAAGG - Intronic
1116208238 14:41897184-41897206 ATGTGGTGTTATCTTGAAGAGGG + Intronic
1116608448 14:47033774-47033796 ATCTGAGGTTCTATAGAAGAGGG + Intronic
1118222704 14:63870129-63870151 ATTTGTGGTTATATTTTGGAGGG - Intronic
1118329314 14:64803429-64803451 ACTTGGGGTGATACAGAAGATGG + Intronic
1118533673 14:66733988-66734010 ATTTGATGTTATTTTGGAGAAGG - Intronic
1120381726 14:83789335-83789357 ATTTGGGGTTAGACTGGGGAAGG - Intergenic
1122275827 14:100590359-100590381 ATTTGGGTTAATATTGCAGTTGG - Intergenic
1125208632 15:37184134-37184156 ATTTGGGGCTATAATGAATTGGG - Intergenic
1126508728 15:49440444-49440466 ATTTGGTTTTATATTATAGATGG - Intronic
1127230992 15:56994899-56994921 ATTTGGGTAAATATTGTAGATGG + Intronic
1128388852 15:67169282-67169304 ATTTGGGGTTACAGGGGAGAAGG + Intronic
1129496979 15:75992763-75992785 ATTTGGGGTTATTTTGCAAATGG + Intronic
1131470266 15:92690395-92690417 ACTCTGGGTTATTTTGAAGAAGG - Intronic
1132162153 15:99552407-99552429 ATTTGCGGTTAATTTGATGAAGG - Intergenic
1133268879 16:4600789-4600811 ACTTGGTGTTGTATTGAAAATGG - Intergenic
1133352781 16:5113183-5113205 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
1133482665 16:6186319-6186341 ATTTGGAGTGAGTTTGAAGAAGG + Intronic
1134782911 16:16914875-16914897 CTATGGGGTCAAATTGAAGAAGG + Intergenic
1135290313 16:21231028-21231050 ATATGGGGATATATTTATGATGG + Intergenic
1136759552 16:32719285-32719307 GTTTGGGGTGATGTTGAATAAGG + Intergenic
1136808552 16:33151101-33151123 GTTTGGGGTGATGTTGAATAAGG - Intergenic
1138177263 16:54911984-54912006 ATTTGGGAGTATATGAAAGAAGG - Intergenic
1139489060 16:67276909-67276931 ATTTGGGGTAGTACTGAAGAGGG + Intergenic
1143920321 17:10326375-10326397 ATTTGGGGATTTATTAAAAAGGG + Intronic
1145177106 17:20710301-20710323 ATTTTTGGTTATATTTAATAAGG + Intergenic
1146853273 17:36241910-36241932 ATTTTTGGTTATATTTAATAAGG - Intronic
1146869181 17:36365800-36365822 ATTTTTGGTTATATTTAATAAGG - Intronic
1147072055 17:37966431-37966453 ATTTTTGGTTATATTTAATAAGG - Intergenic
1147083581 17:38045963-38045985 ATTTTTGGTTATATTTAATAAGG - Intronic
1147099527 17:38169930-38169952 ATTTTTGGTTATATTTAATAAGG - Intergenic
1150082539 17:62253224-62253246 ATTTTTGGTTATATTTAATAAGG - Intergenic
1150090171 17:62316995-62317017 ATTTGGGGTCATATTGAATTTGG + Intergenic
1150753342 17:67887469-67887491 ATTTTGTGTTTTATTGAGGAGGG + Intronic
1151238169 17:72736675-72736697 ATTTGGGGCTATAGAAAAGACGG - Exonic
1154272198 18:12929917-12929939 GTTTGGGGTTATAATGAATGAGG - Intergenic
1154421627 18:14235359-14235381 ATTTGGGAATATATTGATAATGG + Intergenic
1155923549 18:31629898-31629920 GTATGGGGTTACCTTGAAGAAGG - Intronic
1156097973 18:33559547-33559569 ATGTGTGGTTACATTTAAGAAGG - Intergenic
1156602237 18:38622382-38622404 TTTTGGTGTTATATCTAAGAAGG - Intergenic
1158069200 18:53450704-53450726 TTTTGGGGTTATATTTTTGATGG + Intronic
1158075378 18:53522224-53522246 ATTTGGGTTTACAATTAAGATGG + Intronic
1158104923 18:53874554-53874576 ATTTGGGGTCATACTGAATTGGG + Intergenic
1159438887 18:68452293-68452315 ATTTTAGTTTATAATGAAGAGGG + Intergenic
1160212162 18:76890167-76890189 ATTTGGGGGAATATGGATGAAGG - Intronic
1160502623 18:79409950-79409972 GTTTGGGGTTTAAATGAAGATGG + Intronic
1162074724 19:8178043-8178065 TTTTGTATTTATATTGAAGACGG + Intronic
1162402865 19:10456721-10456743 ATTTGGGGTTCCATTGAATTAGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
926860981 2:17308480-17308502 AACTGGGGTTATAATAAAGAAGG + Intergenic
929849065 2:45565570-45565592 TTTTGGTGTTATATCTAAGAAGG - Intronic
930145073 2:47993797-47993819 AATTGGGGTGATAGTCAAGAGGG - Intergenic
931067789 2:58606227-58606249 ATTTAATGATATATTGAAGATGG + Intergenic
931776029 2:65541165-65541187 GTTTGGGGTTTTTTTGGAGATGG + Intergenic
932185718 2:69693738-69693760 ATTTGGGGTTAGGTTTAACAAGG + Intronic
932318247 2:70800837-70800859 CATTGGGGTCATCTTGAAGAGGG + Intergenic
932680127 2:73817729-73817751 ATTTGGATATAAATTGAAGATGG + Intergenic
933916289 2:86997222-86997244 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
934006704 2:87772683-87772705 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935770351 2:106413604-106413626 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935967860 2:108499212-108499234 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936131519 2:109847469-109847491 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936213178 2:110524016-110524038 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936422317 2:112378573-112378595 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936555386 2:113492952-113492974 ATTTGGGGTTATATTGGCAAAGG + Intronic
938272111 2:129981857-129981879 ATTTGAGGTCAAATTGAAGACGG + Exonic
938443897 2:131361956-131361978 ATTTGAGGTCAAATTGAAGATGG - Intergenic
938573474 2:132583640-132583662 ATATGGGTTGAGATTGAAGAGGG + Intronic
942343448 2:174975508-174975530 TTTCGTGGTTGTATTGAAGAAGG - Intronic
942964369 2:181873230-181873252 AAATGGGGTCATATTGAAGAAGG + Intergenic
945852539 2:215026887-215026909 ATTTGCTGATATATTTAAGAGGG + Exonic
946079073 2:217101473-217101495 ACATGGGGTTATAATGGAGACGG - Intergenic
1169165173 20:3416404-3416426 ACTTGAGCTTATATTTAAGAGGG - Intergenic
1169832055 20:9836334-9836356 ATTTGAGGTCATATTGAATAAGG + Intronic
1170255342 20:14336738-14336760 TTTTGGTGTTCTATTGAAGAGGG + Intronic
1171937852 20:31293104-31293126 ATTTTTGTTTCTATTGAAGATGG - Intergenic
1172866619 20:38104744-38104766 TTTTGGTGTTATATTTAAGAAGG - Intronic
1173369276 20:42420298-42420320 GTTTGGGGTTATCATGAAAAAGG + Intronic
1174784658 20:53421209-53421231 ATCTGCGGTGATATTGAACATGG - Intronic
1176662530 21:9651697-9651719 ATTTGGGTATATTTTGAAGTAGG + Intergenic
1180631779 22:17234833-17234855 GTTTGGGGTTGTTTTGAAGGCGG - Intergenic
1180896297 22:19335758-19335780 ATTTGGGTTTATTATGAAGCCGG - Intronic
1181753384 22:25005731-25005753 ATTTGTGGTTAAATTAAATAAGG + Intronic
1183088703 22:35506217-35506239 GTTTGGGGTTGTTTTGAATAGGG + Intergenic
1185064767 22:48626120-48626142 GTTTGGGGTGATTTTGAATAAGG + Intronic
949615520 3:5749811-5749833 GTTTGGGGTGATAGAGAAGAAGG - Intergenic
952510969 3:34055047-34055069 ACTTGGGGTTTTATTTAAGCAGG + Intergenic
955267937 3:57465482-57465504 ATTTGAGGTTATGTTCAGGAAGG - Intronic
956119127 3:65948339-65948361 ATTTGGGGTTTTATGAAACAAGG - Intronic
956538388 3:70305878-70305900 ATTTTGCATTATATTGAAAAGGG + Intergenic
957303864 3:78430780-78430802 ATTTTGGGTTCTTTTGAAAATGG + Intergenic
957383771 3:79468831-79468853 AGTTTGGGTCATATTGAGGATGG + Intronic
957671758 3:83314072-83314094 ATTTGTCTTTATATTTAAGATGG + Intergenic
959171432 3:102848499-102848521 ATTTGAAATTATATTTAAGAGGG - Intergenic
959321465 3:104880598-104880620 GTTTGGGGGTATGTTGAAGGAGG + Intergenic
960048061 3:113215819-113215841 ATTTGGGGTGATAATACAGAGGG - Intronic
960263492 3:115594195-115594217 ATTTGGGACTAGATAGAAGATGG + Intergenic
960352303 3:116608035-116608057 CTATGGGGTTATATTGGAAAGGG - Intronic
961135182 3:124503420-124503442 ATTTGGGCTTAGAGTGGAGATGG - Intronic
961297636 3:125899702-125899724 ATTTGGGGGTGTTTGGAAGAAGG - Intergenic
962118961 3:132541933-132541955 ATTTGGGGTTAATATGAGGATGG - Intergenic
962353540 3:134673805-134673827 ATTTGGGGTTGTCCTGCAGAAGG - Intronic
962493485 3:135916774-135916796 ATTTGGGCTCATTTTGAAGATGG + Intergenic
962510481 3:136094928-136094950 TTTTGGGTCTATATTCAAGAGGG - Intronic
964362055 3:155908621-155908643 ATTTGCTGTTAGATTGAATATGG + Intronic
965730444 3:171766386-171766408 TTTAGGGGTTATTTTGAAGGTGG - Intronic
968999581 4:3969439-3969461 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
969719561 4:8885738-8885760 ATTTGAGGTTATTTTAAAGCTGG - Intergenic
969754427 4:9139195-9139217 ATTTGGGGGTGTTTGGAAGAAGG - Intergenic
970775853 4:19673116-19673138 ATTTGGGGTTATATTTTAAATGG + Intergenic
971345967 4:25812154-25812176 ATGTGTGGTCATATAGAAGAAGG - Intronic
972923616 4:43975102-43975124 AGTTGAGGTGAAATTGAAGAAGG - Intergenic
973927611 4:55755345-55755367 ATTTATGTTTATATTGAAGCAGG - Intergenic
976595132 4:86888598-86888620 AAATGTGGTCATATTGAAGAAGG + Intronic
976599928 4:86928603-86928625 ACTTGGGGTTGTGTTGAAGCAGG + Intronic
977964477 4:103128031-103128053 ATGTGTCCTTATATTGAAGATGG - Intronic
978547095 4:109882202-109882224 ATTGGGGTTTAAATTGAATATGG + Intergenic
980677969 4:136114877-136114899 ACTTGAGGGTATATTAAAGAAGG + Intergenic
981740189 4:147992941-147992963 ATTGGAGGGTGTATTGAAGAAGG + Intronic
986239427 5:5944460-5944482 AATGGGAGTTATATTTAAGAAGG - Intergenic
989091112 5:37732877-37732899 TTTTGGGGTTTTATTTAGGAAGG + Intronic
989116745 5:37962189-37962211 AGTTGGGATCAGATTGAAGAAGG + Intergenic
990054944 5:51562224-51562246 ATTTTAGGTTAAATTTAAGAAGG + Intergenic
990717570 5:58655657-58655679 ATTTTGGGTTATATTTACCATGG - Intronic
991181187 5:63752917-63752939 CTTTGGGATTCCATTGAAGATGG + Intergenic
991259943 5:64656008-64656030 ATGTTAGGTTATATTGAAAATGG - Intergenic
991516635 5:67443390-67443412 ATTTGCTTTTATATTGAATAGGG + Intergenic
992173876 5:74130519-74130541 ATTTGGGGATATTTTGAGCATGG - Intergenic
992245489 5:74818103-74818125 TTTTGGTGTTATATCTAAGAAGG - Intronic
995656881 5:114435850-114435872 ATTTTGGGTTATCTTCAAGAAGG + Intronic
997059670 5:130486583-130486605 ATTTGGGCTAATATTGACTAGGG + Intergenic
998902895 5:146874889-146874911 GTATGGGGTTATATAGAGGAAGG - Intronic
999295200 5:150455167-150455189 ATTTGGTTTTATTTTGAAAATGG + Intergenic
999672612 5:153970936-153970958 ATTTGGGGGTGTCTTGGAGAAGG + Intergenic
1000859604 5:166440428-166440450 TTTTGGTGTCATATTTAAGAAGG + Intergenic
1001025095 5:168217356-168217378 ACTTTGGGTGATATTGTAGAGGG - Intronic
1001190636 5:169627560-169627582 ATTTGGGGTAGTGTTTAAGAAGG + Intergenic
1003185169 6:3824101-3824123 AGTTGGGGAAATATTGAAGGGGG + Intergenic
1004977411 6:20983714-20983736 TTTTTGGGTTATTTTTAAGACGG - Intronic
1005025187 6:21455894-21455916 ATTAGCAGTCATATTGAAGAAGG - Intergenic
1005115979 6:22337401-22337423 ATTTAGGGTTAGATTGAGAAGGG + Intergenic
1005853384 6:29839984-29840006 TTTTGGGGTTTTTTTTAAGATGG - Intergenic
1006545502 6:34777531-34777553 ATTTGTGACTATTTTGAAGAGGG + Intergenic
1007212820 6:40210685-40210707 AGTTGGGGTGACATTGAAGTGGG - Intergenic
1007910154 6:45505392-45505414 ACTTGGAGTTATATTGAGAAGGG - Intronic
1009597898 6:65759729-65759751 ATTTGTGTTTATATTGAATACGG - Intergenic
1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG + Intronic
1010273656 6:73943773-73943795 ATCTAGGGTCATTTTGAAGATGG + Intergenic
1010661464 6:78576061-78576083 TTTTATGGTTATATTAAAGATGG - Intergenic
1011382030 6:86752524-86752546 ACTTGGGGATATATAGAAAAAGG - Intergenic
1011819266 6:91231542-91231564 ATTTGTGCTTATATAGAACAAGG + Intergenic
1012750168 6:103151592-103151614 AATTTGTGTTATTTTGAAGAGGG - Intergenic
1012876008 6:104726619-104726641 TTTTGGGGTTAACTTGAAAATGG + Intergenic
1012928612 6:105293782-105293804 ATTTGCCCTTCTATTGAAGAGGG - Intronic
1013090136 6:106892993-106893015 AGATGAGGTGATATTGAAGATGG - Intergenic
1014316537 6:119872711-119872733 ATTTGGGGTTATAATGTATTTGG - Intergenic
1015438869 6:133224129-133224151 ATCTGGGGTTATATTAAATCAGG - Intergenic
1017973743 6:159336131-159336153 ATTTGGTGTCAGATTAAAGAGGG + Intergenic
1018489500 6:164277365-164277387 ATTTGGTGTTATATAGGAAAAGG + Intergenic
1020506016 7:8988797-8988819 ATTTAGGGTTAGATTGAGCAGGG + Intergenic
1020931579 7:14403517-14403539 ATTTGGGGTTTTTTTTAAAATGG - Intronic
1021208979 7:17821185-17821207 TTTTGGGCTTAGATTGAAGTAGG - Intronic
1022518531 7:30990534-30990556 AATTGGGGCTATATGGAAGAAGG - Intronic
1023132479 7:37016569-37016591 ATCTGGGTTTATGTTGAAGGAGG - Intronic
1024412445 7:49060748-49060770 ATTTTGGGTTCCATGGAAGAAGG - Intergenic
1025521324 7:61733845-61733867 ATTTAGGCTTATAGTGAAAAAGG - Intergenic
1025521802 7:61743049-61743071 ATTTAGGCTTATAGTGAAAAAGG - Intergenic
1029898845 7:104018662-104018684 ATTTGGGGGTATTTTGAAGCAGG + Intergenic
1030151528 7:106410987-106411009 GTTTGGGGTTTTTTTAAAGATGG + Intergenic
1031006870 7:116483191-116483213 ATTTGGGGTGATATGGAGAAAGG - Intronic
1032371355 7:131356468-131356490 CTTTGGGGTTAAATGGACGAAGG + Intronic
1034763371 7:153694597-153694619 ATATGGGGTTTTATTGGAGGGGG + Intergenic
1035087777 7:156275950-156275972 ATTGGGGGTAATATTGAGGCAGG + Intergenic
1035987576 8:4451600-4451622 TTTAGAGGTTATATTCAAGAAGG + Intronic
1036016946 8:4795828-4795850 ATTTGTGTTTAATTTGAAGAAGG - Intronic
1036377654 8:8214523-8214545 ATTTGGGGGTGTTTGGAAGAAGG - Intergenic
1036575017 8:10019347-10019369 ATTTGAGGTTTTATAGTAGACGG + Intergenic
1036851909 8:12208626-12208648 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
1036873275 8:12451144-12451166 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
1037096518 8:14992964-14992986 TTTTGGGGGTAGATTGAAGGAGG - Intronic
1037153967 8:15676844-15676866 CTTTGGGGTTATATGCTAGATGG - Intronic
1037226190 8:16593878-16593900 ATTTGGGGATATCAGGAAGAAGG + Intergenic
1039415682 8:37392085-37392107 ATTTGGGATTTTTTTGGAGAGGG + Intergenic
1039833031 8:41232860-41232882 ATTTGGGGCTATTATGAAAAAGG + Intergenic
1040994209 8:53385156-53385178 GTTTGGGGCTATAGTGAATAAGG + Intergenic
1045399329 8:101796285-101796307 ATTTGGGATTGAATTGAAAATGG - Intronic
1046359388 8:113131088-113131110 ATTTGAAGTTATATTTAAAAGGG + Intronic
1046735643 8:117773832-117773854 CTTTTGGTTTTTATTGAAGAAGG - Intergenic
1048142435 8:131807491-131807513 ATTAGGGGATATTTTGAAGCAGG + Intergenic
1049897608 9:124236-124258 ATTTGGGGTTATATTGGCAAAGG - Intronic
1050060949 9:1709205-1709227 ACTTGGGGTAACATTGAAAAAGG + Intergenic
1050600452 9:7245268-7245290 ATTTTGGGTTATTTGGAAGATGG + Intergenic
1052695508 9:31872229-31872251 ATTTGGGGTTTTATTTGTGATGG - Intergenic
1053740699 9:41134524-41134546 ATTTGGGGTTATATTGGCAAAGG - Intronic
1054443690 9:65290679-65290701 ATTTGGGGTTATATTGGCAAAGG - Intergenic
1054486584 9:65730824-65730846 ATTTGGGGTTATATTGGCAAAGG + Intronic
1054687651 9:68296776-68296798 ATTTGGGGTTATATTGGCAAAGG + Intronic
1055206136 9:73732729-73732751 TTTACGGGTTAGATTGAAGAGGG + Intergenic
1055865085 9:80803354-80803376 ACTTGGAGTTATATAGGAGATGG - Intergenic
1056146906 9:83740486-83740508 ATTTATGGTTAAATTGAAGGGGG - Intronic
1058559326 9:106207853-106207875 TTTTGGTGTTAAATTTAAGAAGG + Intergenic
1202803743 9_KI270720v1_random:28953-28975 ATTTGAGGTTATAGTGAACTAGG + Intergenic
1188418939 X:29972852-29972874 AGTTGTGGTCATATTGGAGATGG + Intergenic
1190101238 X:47524236-47524258 TTTTGAGGTTATTCTGAAGAGGG - Intergenic
1190632690 X:52403121-52403143 TTTTGGTCTTATCTTGAAGAAGG - Intergenic
1190978710 X:55434358-55434380 ATTTGAAAATATATTGAAGATGG + Intergenic
1191048546 X:56165875-56165897 ATTGGTGGTGATATTCAAGAAGG - Intergenic
1191900082 X:66031849-66031871 ATTTGGGTTTACAATGAAGTGGG + Intronic
1193225039 X:78972392-78972414 ATTTGGTCTTATATTAAAAAGGG - Intergenic
1193464521 X:81832110-81832132 AGGTGGGGTAACATTGAAGAGGG + Intergenic
1193520124 X:82519283-82519305 ATTTGAGCTTATATTTAAAAGGG - Intergenic
1193603817 X:83541680-83541702 ATTTGGGGTCATAATCATGAAGG + Intergenic
1194823176 X:98530237-98530259 CTTTGGGGGTACAATGAAGAAGG - Intergenic
1196271198 X:113713183-113713205 GTTTGGGGCTATTTTGAATAAGG + Intergenic
1197088314 X:122506458-122506480 ATTTGGCTTTCTATTGAAGAAGG + Intergenic
1198885884 X:141335887-141335909 ATTTAGGGTCACACTGAAGAAGG + Intergenic
1200525595 Y:4271253-4271275 ATTTAGGGTTATCTGGAGGAAGG - Intergenic
1200759327 Y:7023142-7023164 ATTTGGGATTATCCTGAAAAAGG + Intronic
1201754094 Y:17467934-17467956 ATTTGGGGTTGTGTTCATGAAGG + Intergenic
1201847458 Y:18438051-18438073 ATTTGGGGTTGTGTTCATGAAGG - Intergenic