ID: 1064189118

View in Genome Browser
Species Human (GRCh38)
Location 10:13189862-13189884
Sequence CACCCCTGGATTACAGCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064189118_1064189121 -1 Left 1064189118 10:13189862-13189884 CCTGACGCTGTAATCCAGGGGTG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1064189121 10:13189884-13189906 GTCCAATCTTTTGGCTTCCCTGG 0: 680
1: 1004
2: 719
3: 347
4: 250
1064189118_1064189122 0 Left 1064189118 10:13189862-13189884 CCTGACGCTGTAATCCAGGGGTG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1064189122 10:13189885-13189907 TCCAATCTTTTGGCTTCCCTGGG 0: 728
1: 1007
2: 643
3: 334
4: 297
1064189118_1064189119 -10 Left 1064189118 10:13189862-13189884 CCTGACGCTGTAATCCAGGGGTG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1064189119 10:13189875-13189897 TCCAGGGGTGTCCAATCTTTTGG 0: 21
1: 174
2: 661
3: 808
4: 780
1064189118_1064189124 9 Left 1064189118 10:13189862-13189884 CCTGACGCTGTAATCCAGGGGTG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1064189124 10:13189894-13189916 TTGGCTTCCCTGGGCCCCTTTGG No data
1064189118_1064189128 23 Left 1064189118 10:13189862-13189884 CCTGACGCTGTAATCCAGGGGTG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1064189128 10:13189908-13189930 CCCCTTTGGAAGAATTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064189118 Original CRISPR CACCCCTGGATTACAGCGTC AGG (reversed) Intronic
903497431 1:23778941-23778963 CAGCCCTGGAATAGAGCGTTAGG - Intronic
907018346 1:51039963-51039985 CACCACTGCATTACAGCCTGGGG + Intergenic
917524078 1:175771741-175771763 CACCTCTGCATCACAGCGTTTGG - Intergenic
924861117 1:247923574-247923596 CACCCCCGGATCCCAGTGTCTGG + Intergenic
1064189118 10:13189862-13189884 CACCCCTGGATTACAGCGTCAGG - Intronic
1066258176 10:33702412-33702434 CACCACTGCATTACAGCCTGGGG + Intergenic
1067913179 10:50367874-50367896 CACCACTGGATCACAGGATCAGG + Intronic
1069833269 10:71293875-71293897 CCTCCCTGGAGTACAGCCTCCGG + Exonic
1071707539 10:88015696-88015718 CACCACTGGACTCCAGCGTGGGG + Intergenic
1075262916 10:120978482-120978504 AACCCCTGGAATACAGGCTCCGG + Intergenic
1076478398 10:130768118-130768140 TACCCCTGGATCACAGTGCCAGG + Intergenic
1079355969 11:19730539-19730561 CAGCCCTGGAAGTCAGCGTCTGG - Intronic
1085534138 11:77208047-77208069 CACCTCTGGGTCCCAGCGTCTGG - Intronic
1090769390 11:129906447-129906469 GACCCCTGGATTTCAACGCCTGG - Intronic
1091748830 12:3010205-3010227 CACCCCTGGATTCCATTGTGTGG + Intronic
1097561470 12:61211912-61211934 CATCCCTAGATTACAGCATTGGG + Intergenic
1098197715 12:68019486-68019508 TACCTCTGGAGCACAGCGTCTGG + Intergenic
1118151890 14:63198504-63198526 CACCCCTGGATCACAGAGTGGGG + Intergenic
1126595611 15:50381967-50381989 CACCACTGTATTCCAGCCTCGGG - Intergenic
1131963244 15:97810580-97810602 GACCCCTGGATTCCAACTTCTGG + Intergenic
1133190644 16:4131272-4131294 CACCACTGCATTCCAGCGTGGGG + Intergenic
1133340788 16:5034393-5034415 AACTCCTGGGTTACAGGGTCAGG - Intronic
1133464728 16:6018935-6018957 CAGCCCTGGATTCCAGCGGGCGG - Intergenic
1144463239 17:15475241-15475263 CACCACTGCATTCCAGCCTCGGG + Intronic
1152144057 17:78557065-78557087 AACCTCTTGATTACTGCGTCAGG + Intronic
1153929042 18:9862304-9862326 CACCACTGGACTACAGGGTCTGG - Exonic
1157046412 18:44105933-44105955 GACCCTTGGATGACAGAGTCAGG - Intergenic
1160441049 18:78892844-78892866 CTGCCCGGGATTACGGCGTCAGG - Intergenic
1161570485 19:5028016-5028038 CACCCCTGCACTCCAGCCTCTGG - Intronic
1161804687 19:6435977-6435999 CACCCCTGCATTCCAGCCTGGGG + Intergenic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
926033232 2:9611710-9611732 CACCACTGCATTCCAGCCTCTGG - Intronic
926985611 2:18619614-18619636 CACCACTGGATTTCAGCACCTGG + Intergenic
930388786 2:50734012-50734034 CACCCCTGGTTTAGACCTTCTGG - Intronic
934989746 2:98912838-98912860 CACCCCCGGATTCCACCGTCAGG - Intronic
1168763202 20:363719-363741 TACCCCTGGGGTACAGGGTCTGG - Intronic
1169118807 20:3083440-3083462 CTCCCGTGGACTACAGCGTGGGG + Intronic
1169785031 20:9350598-9350620 CACCACTGTATTACAGCCTTGGG - Intronic
1172596433 20:36154202-36154224 CACCCCTGCAGCACAGCGACAGG - Intronic
1175491195 20:59382112-59382134 CAGCCCATAATTACAGCGTCAGG + Intergenic
1180995068 22:19961499-19961521 CACCCCTGGAGGCCAGCCTCAGG - Intronic
1182032706 22:27172018-27172040 TACCACTGGATTACAGAGGCAGG + Intergenic
1183990967 22:41596916-41596938 CACCCCTGGCTTGCAAGGTCAGG - Intergenic
1185138353 22:49086663-49086685 CACCCCTGGACCAGAGAGTCTGG + Intergenic
954203031 3:49036311-49036333 CACCCCTGGCATACAGAGTAAGG + Intronic
957063148 3:75498615-75498637 CACCCCTGTGATACAGCCTCAGG - Intergenic
957859769 3:85931399-85931421 CACCCCTGCAATCCAGCCTCGGG + Intronic
963056650 3:141191574-141191596 CATCCCTGGATTCCAGTGTCTGG + Intergenic
968929513 4:3571171-3571193 CACCACTGGCTTCCAGGGTCTGG - Intergenic
969314403 4:6372784-6372806 CACCCCTGTGTTCCAGCCTCCGG - Intronic
975810409 4:78162735-78162757 CACTCCTGCCTTACAGCCTCAGG - Intronic
997313909 5:132915794-132915816 CACTCTGGGATTACAGGGTCAGG - Intronic
1003040875 6:2686142-2686164 TACCCCTGGATTCCTGCCTCAGG - Intronic
1012997339 6:105986498-105986520 CACCCCAGGAAGACCGCGTCGGG + Intergenic
1025993916 7:66516145-66516167 CACCCCTGCATTTCAGCCTGGGG + Intergenic
1027136782 7:75630120-75630142 CACCACTGCATTCCAGCCTCAGG + Intronic
1028318561 7:89434373-89434395 CAACCTTGGATGACAGAGTCCGG - Intergenic
1035907564 8:3530561-3530583 CACCCCTGCATTCCAGCTTGGGG - Intronic
1039089207 8:33810405-33810427 CACCACTGCATTCCAGCCTCAGG + Intergenic
1039455625 8:37704018-37704040 CACCCCTGGAGTCCAGGGTAGGG + Intergenic
1039919665 8:41884376-41884398 CACCACTGCATTAAAGGGTCTGG + Intronic
1041107696 8:54458534-54458556 CACCCCTGGTTTTGGGCGTCAGG - Intronic
1042648200 8:71010492-71010514 TACGTCTGGATTACAGGGTCAGG + Intergenic
1047897001 8:129377433-129377455 AACACCTTGATTACAGCCTCAGG + Intergenic
1053804203 9:41784607-41784629 CACCACTGGCTTCCAGGGTCTGG - Intergenic
1054460766 9:65461295-65461317 CACCACTGGCTTCCAGGGTCTGG + Intergenic
1054645894 9:67592588-67592610 CACCACTGGCTTCCAGGGTCTGG + Intergenic
1057669051 9:97072452-97072474 GACACCTGGATTACAGCCTCAGG + Intergenic
1060765784 9:126294316-126294338 CACCCCTGGATGGCAGGATCGGG - Intergenic
1202101117 Y:21309114-21309136 CACCACTGCATTACAGCCTGGGG + Intergenic