ID: 1064189879

View in Genome Browser
Species Human (GRCh38)
Location 10:13196453-13196475
Sequence ATCACAAGTACTGAGTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064189879 Original CRISPR ATCACAAGTACTGAGTAATA TGG (reversed) Intronic
901214320 1:7546833-7546855 ATCACCAGTCATGAGTAAAATGG - Intronic
901647690 1:10725371-10725393 CTCTCAAGTACTGAGCCATATGG + Intronic
905114933 1:35630250-35630272 GTCACAGGTATTAAGTAATATGG + Intronic
907776070 1:57516560-57516582 ATGACAAGATCAGAGTAATATGG - Intronic
909424077 1:75501207-75501229 AATACAAGTACAGATTAATAGGG + Intronic
909884529 1:80924422-80924444 ATCCAAAGCACTGAGTTATATGG + Intergenic
912053010 1:105554483-105554505 AACAAAAGTACTCTGTAATAGGG + Intergenic
917080212 1:171250151-171250173 ATCCCAATTACTTAATAATAAGG + Intronic
917186195 1:172358941-172358963 AGCACAAGTAATGAGTCATGTGG - Intronic
917581527 1:176383388-176383410 ATAACAAATACTTAGAAATACGG - Intergenic
917784468 1:178438420-178438442 AGCAGAAGTACTTAGTAATAAGG - Intronic
918673138 1:187246246-187246268 ATCACAATTATTGATTTATATGG + Intergenic
919706799 1:200684149-200684171 CTCACAAGAAATGAGTAAGAAGG + Intergenic
921564240 1:216697475-216697497 ATCTCAGGTACTGAGAATTAAGG - Intronic
922402822 1:225277609-225277631 ATCACAATAACTGAGTCATAGGG + Intronic
1064189879 10:13196453-13196475 ATCACAAGTACTGAGTAATATGG - Intronic
1072482615 10:95824070-95824092 CTCACAAGTACTTTGTAATATGG + Intronic
1073227320 10:101933237-101933259 ATCACAAGTAATAAAAAATAGGG + Intronic
1073740211 10:106398188-106398210 ATCAAAAATACTTATTAATATGG - Intergenic
1075993023 10:126853976-126853998 ATCAAAGGTCCTGATTAATATGG + Intergenic
1084028152 11:66465883-66465905 ACCAAGAGTACTGAGCAATAGGG + Intronic
1087441386 11:98188001-98188023 ACCACATATGCTGAGTAATAAGG + Intergenic
1087980004 11:104600267-104600289 AGCACAAGTACTGGTTCATATGG - Intergenic
1091186418 11:133651613-133651635 ATCACATGTTCTGACTTATATGG - Intergenic
1092655352 12:10678108-10678130 ATCACAGGTTCTGAGGATTAGGG + Intergenic
1093754497 12:22837394-22837416 ATAACAAGTACTTAGTAAGTGGG - Intergenic
1097646315 12:62238606-62238628 ATTAAAATTACTGAGTATTAAGG - Intronic
1099769684 12:87035009-87035031 ATTACAAGAACGGATTAATAAGG - Intergenic
1099801440 12:87461825-87461847 AACACAAAGATTGAGTAATAGGG + Intergenic
1099876407 12:88411550-88411572 ATTACTATTACTGAATAATATGG - Intergenic
1100504425 12:95205783-95205805 ATCAAAAGCCCTGAGTCATAGGG - Intronic
1101191248 12:102335759-102335781 ATCACAAGGACTGTGAAAGAGGG - Intergenic
1102209341 12:111113216-111113238 ATCACAAGTTCTGAGTCAGATGG - Intronic
1108546009 13:51494802-51494824 ATCAAAATTACTGAATTATATGG - Intergenic
1109821008 13:67654488-67654510 ATCTCTAGTACTGAAAAATACGG - Intergenic
1109930740 13:69214291-69214313 ATCAAAACTTCTGAGAAATATGG - Intergenic
1111388013 13:87554672-87554694 CTCACAAGAACTGAGAATTATGG - Intergenic
1112029414 13:95443557-95443579 ATCACAAGGACTCAGGAACATGG - Intronic
1112121744 13:96419939-96419961 TTCACAAGTACTAAGGGATAGGG + Intronic
1114539464 14:23443897-23443919 ATCACAAGTACAAAATAACATGG + Intergenic
1120487552 14:85133264-85133286 ATCACAAAGAATGAGAAATAGGG + Intergenic
1121522563 14:94596425-94596447 ATGACAAGTACTGTGGAATGAGG + Intronic
1131961861 15:97797943-97797965 ATCATAACATCTGAGTAATAAGG - Intergenic
1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG + Intergenic
1141966729 16:87450521-87450543 AACAAAAGTAGTGAGTAATTGGG + Intronic
1144641805 17:16941343-16941365 GGCACAAGTCCTGAGTCATAGGG - Intronic
1150064709 17:62099381-62099403 AACAGAAGTACAGAGAAATATGG + Intergenic
1152021555 17:77782407-77782429 ATGACAATGACAGAGTAATAAGG + Intergenic
1153081791 18:1235374-1235396 AACAAAACTTCTGAGTAATATGG - Intergenic
1155102835 18:22629957-22629979 ATCACAACTCCTGAAAAATAAGG - Intergenic
1158756000 18:60326326-60326348 ATGACAAGGACTGAAGAATAGGG - Intergenic
1160570490 18:79814221-79814243 ATCACAATTGCTGGGTCATACGG - Intergenic
926459197 2:13108234-13108256 AGCACAAATACTGAGAGATAGGG - Intergenic
928627861 2:33159236-33159258 ATCACAAATAATGAAAAATATGG + Intronic
930675126 2:54192361-54192383 AAAATAAGTACTGTGTAATAGGG - Intronic
933417462 2:82004661-82004683 ATCTCAATTACTGAGTAAGGAGG - Intergenic
938619820 2:133038845-133038867 GTCACAGGTTCTGAGTATTAGGG + Intronic
938902991 2:135814378-135814400 ATCACAACTGCTTAATAATAGGG + Intronic
941388616 2:164883748-164883770 ATCACAATTGCTGAGTCATAAGG + Intergenic
941480609 2:166005090-166005112 AACTCTAGTACAGAGTAATATGG - Intronic
941620150 2:167768445-167768467 ATCATAAATACTGAGTAAGGAGG - Intergenic
941723391 2:168836162-168836184 ATAACAAGTATTGAATAATGAGG + Intronic
1171418869 20:25003835-25003857 ATAAAAAGTACTGAGTTAGATGG + Intergenic
1172860588 20:38047120-38047142 ATCACAAATACCAAGTAATTGGG + Intronic
1173960222 20:47065262-47065284 ATGAGAAGCACTGGGTAATATGG - Intronic
1179072297 21:38083136-38083158 ATCACAAATCCTGGGTAATCTGG + Intronic
1181860000 22:25810829-25810851 ATCACAAGATATCAGTAATAGGG - Intronic
1183153039 22:36053254-36053276 CTCACAAGTGCTGAGCAAGATGG - Intergenic
951078836 3:18426765-18426787 AGCACAAGTACTGAGATAAAAGG + Intronic
951314191 3:21168430-21168452 ATCTCAAGCACTGAGGAAAAAGG - Intergenic
956904168 3:73748744-73748766 CTTTCAAGTACTGAGTATTATGG - Intergenic
957207988 3:77222426-77222448 GTCAGAAGAACTGAGTAATAAGG + Intronic
957284881 3:78205126-78205148 ATCAAAATTACTGAGGAATTTGG + Intergenic
959328706 3:104973736-104973758 ATCACAAGTATTAAGAAAGAGGG - Intergenic
959548283 3:107623529-107623551 ATCCCAGGTTCTGAGTAAGAAGG - Intronic
960434681 3:117611291-117611313 CTCACAAGAACTGATTAAGAAGG + Intergenic
961155669 3:124677545-124677567 TTCACAAACACTGAGTGATATGG + Intronic
965878510 3:173358780-173358802 ATCACAAATACATAGTAATGTGG - Intergenic
966030596 3:175342272-175342294 ATCACAAGCACTGAGATAAAAGG + Intronic
967340435 3:188391255-188391277 TCCAGAAGTACTGAGTGATATGG - Intronic
970229677 4:13896852-13896874 ATCAGATGTACAGAGTAAGAAGG + Intergenic
971356287 4:25897975-25897997 ATCACAGGCACTGAGGATTAGGG + Intronic
972340079 4:38144806-38144828 ATGACAAGCACTGAGTACTGTGG + Intergenic
972431316 4:38985129-38985151 GACACATGTACTGAGTAAGAGGG + Intronic
974396253 4:61338995-61339017 ATCATCAGTACTCATTAATAAGG - Intronic
976399024 4:84586706-84586728 ATCAGTAGTACTTAGGAATAAGG + Intronic
979097072 4:116564164-116564186 AACACAACTTCTGAGAAATATGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980008933 4:127574740-127574762 ATCAGGAGTACTGAGAAAAATGG + Intergenic
982539748 4:156653887-156653909 ATCACAGGGCCTGAGAAATAAGG + Intergenic
987883628 5:23783036-23783058 TTCACAATTTCTGAGTATTAGGG - Intergenic
995009259 5:107239514-107239536 AGGACAAGTACTGAGAAAAATGG - Intergenic
995723310 5:115160109-115160131 ATCAAAAGTATACAGTAATATGG + Intronic
995756495 5:115510674-115510696 ATCATAAGTACCAAGTATTAAGG - Intergenic
999039381 5:148390122-148390144 ATCTCAGGTACTGATGAATAGGG - Intronic
999804249 5:155067271-155067293 ATCATAGGTACTGATTAAAAGGG + Intergenic
1002338104 5:178494414-178494436 ATCAAAAGTGCTGGGTAATTTGG + Intronic
1005019107 6:21400904-21400926 ATTACTAGAACTGAGTAATCTGG - Intergenic
1008710174 6:54215398-54215420 ATCACAAATACTTATTAGTATGG - Intronic
1008771224 6:54981082-54981104 TTCATAAGTACTGAATAATGAGG + Intergenic
1013243116 6:108263859-108263881 ATCACAATTCCTGAAAAATAAGG - Intergenic
1013354787 6:109337147-109337169 ATGCCAAGAACTGAGTAATGGGG - Intergenic
1015134121 6:129848372-129848394 ATCACAGGTAAAGAGTAAAAGGG + Intronic
1016266216 6:142235250-142235272 TTCACAAGTACTGGGGATTACGG - Intergenic
1021504352 7:21364899-21364921 ATGAGAATTACTGAGTCATATGG - Intergenic
1022697329 7:32720935-32720957 ATTACAATTGCTGAGTTATAAGG + Intergenic
1023759947 7:43456056-43456078 ACCACAATTACTGTTTAATATGG + Intronic
1026560955 7:71448594-71448616 AAAACAAGTACTGAGTGTTATGG - Intronic
1033079029 7:138277667-138277689 ATTACAATTACTGGGTCATATGG - Intergenic
1034153925 7:148938775-148938797 AGAACAAGTACTGATTAAAAAGG - Intergenic
1038981612 8:32765663-32765685 ATCACAAGTAATGATTCATCAGG + Intergenic
1044050387 8:87494976-87494998 ATCACAACTACTGGATCATATGG + Intronic
1044506129 8:93022027-93022049 ATCAGAAGTACAAATTAATAAGG + Intergenic
1045820018 8:106325597-106325619 ATCACATGTACTGAGCAAGCTGG - Intronic
1046036691 8:108851315-108851337 AACACCAATACTGCGTAATACGG + Intergenic
1054972066 9:71099403-71099425 ATTGCAAGTACTGACTGATATGG - Intronic
1055815056 9:80195250-80195272 ATAATAAATACAGAGTAATATGG + Intergenic
1055927033 9:81521080-81521102 ACCACAGGTTTTGAGTAATAAGG + Intergenic
1058853847 9:109040200-109040222 ATCACAAGTAATGAGGTAGAGGG - Intronic
1058918243 9:109588076-109588098 TTCACAGGTACTGAGAAGTAGGG - Intergenic
1061317617 9:129806501-129806523 ATCAGACATACTGAGGAATAAGG - Intronic
1186292018 X:8110684-8110706 AACACAAGGGCTGAGTAAGAGGG + Intergenic
1186706616 X:12146392-12146414 ATAACAAGTTCAGAGAAATATGG - Intronic
1187137108 X:16558649-16558671 AACAAAAGCACTGAGTAAGAGGG - Intergenic
1188822015 X:34786998-34787020 ATCACAAACTCAGAGTAATAGGG - Intergenic
1189081445 X:37977299-37977321 ATCCCTAGTACTGAGTAGGATGG - Intronic
1194427260 X:93754618-93754640 ATTAAAAGTATTTAGTAATAAGG - Intergenic
1197497243 X:127199963-127199985 AACACATGTACATAGTAATAGGG - Intergenic
1198657786 X:138933506-138933528 ATCACATTTACTGAGCAACAAGG - Intronic
1198692176 X:139296315-139296337 AACACAACTACAGAGTAAAAGGG - Intergenic