ID: 1064190023

View in Genome Browser
Species Human (GRCh38)
Location 10:13197706-13197728
Sequence TCACCTCCAGGATGTCCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064190023_1064190027 17 Left 1064190023 10:13197706-13197728 CCCTCAGGACATCCTGGAGGTGA 0: 1
1: 0
2: 3
3: 20
4: 235
Right 1064190027 10:13197746-13197768 AACACCATGTTTTCTTCTCAAGG 0: 1
1: 0
2: 3
3: 29
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064190023 Original CRISPR TCACCTCCAGGATGTCCTGA GGG (reversed) Exonic
900429543 1:2595308-2595330 TCTCCTCCAGGATGTAGTCAGGG + Exonic
900432038 1:2607019-2607041 CCACCTCCAAGATGTCCAGCAGG + Exonic
900977937 1:6028732-6028754 TGACCTCCAGGATGGCCTCCAGG + Intronic
900998682 1:6136557-6136579 GCTCCTCCAGGTTGTTCTGAAGG + Exonic
901400147 1:9010232-9010254 TCCCCTCCAGGCTGTCCTTGTGG - Exonic
902664790 1:17929953-17929975 ACCCCTCCAGGGTGTCATGATGG - Intergenic
902779804 1:18697728-18697750 TCTCCTCCAGGAAGTCCTCCTGG + Intronic
905911229 1:41656318-41656340 TCAGCTGCAGGCTGGCCTGAGGG - Intronic
907523429 1:55039848-55039870 TCAGCTCCAGGCGGTCCTGGTGG + Exonic
907978188 1:59454092-59454114 TAAACTCCAGGTTGTCCTTATGG - Intronic
908516895 1:64901894-64901916 TCACCTACACAATGTCCTCAGGG + Intronic
909258183 1:73451137-73451159 TCAACTCCAGGCTTTCTTGATGG + Intergenic
911530077 1:99033467-99033489 TCACCTCCAGGATTTCTTTTTGG - Intergenic
912859075 1:113196951-113196973 TTAGCTCCAGCATGTCCTCAGGG + Intergenic
914915879 1:151818922-151818944 TCACCTCAAGTCTGGCCTGAGGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
919587586 1:199458020-199458042 TCACCTACAAAATGTCCTCATGG - Intergenic
920776731 1:208945565-208945587 TCTCCACAAGGATGTCATGAAGG - Intergenic
923378306 1:233389113-233389135 TCACCTCCATGATTTCCATATGG + Intergenic
923896951 1:238281429-238281451 TCACCTGTAGTATGTGCTGATGG - Intergenic
1063611039 10:7562172-7562194 TCACCTCCTGGATGACCACAAGG + Exonic
1063927147 10:10991510-10991532 TCACCCCCAGGATGCACTGGTGG - Intergenic
1064190023 10:13197706-13197728 TCACCTCCAGGATGTCCTGAGGG - Exonic
1065328946 10:24573809-24573831 CCACCCCCAGGATGTACTAACGG - Intergenic
1066083558 10:31955559-31955581 TCACATCCAGGGTATGCTGATGG - Intergenic
1066122046 10:32298690-32298712 TCACTTCCAGAATGTACTTAGGG + Intronic
1066471776 10:35705392-35705414 TGTCCTCCAGGATGTCTTGCTGG - Intergenic
1067018033 10:42772076-42772098 TCAGGTCAGGGATGTCCTGAAGG + Intergenic
1067567502 10:47349477-47349499 CTGCCTCCAGGAGGTCCTGAAGG + Exonic
1068770966 10:60820224-60820246 TCACCCTCAAGATGTCCTGCGGG + Intergenic
1069436345 10:68387609-68387631 ATAGCACCAGGATGTCCTGATGG + Intronic
1069861457 10:71474206-71474228 TCACCTCCAGGGAGCCCTCAGGG + Intronic
1070309225 10:75261274-75261296 GCACCTCTAGCTTGTCCTGAGGG + Intergenic
1070812317 10:79304677-79304699 TCACCTGCAGCTGGTCCTGAGGG + Intronic
1071254856 10:83862912-83862934 TCATCTCCATGACTTCCTGATGG - Intergenic
1072007797 10:91271727-91271749 TCACCGCCATGGTGTCATGATGG - Intronic
1076439070 10:130467190-130467212 CAGCCTCCAGGATCTCCTGAAGG - Intergenic
1077389603 11:2294030-2294052 TCACCAGCAGAATGTCATGAGGG + Intergenic
1078182256 11:9021872-9021894 TCACCTTAAGTATTTCCTGATGG + Exonic
1078868783 11:15324792-15324814 TAACCTCCAGGATGGGCTGAGGG + Intergenic
1079145377 11:17846581-17846603 TCACCTCCAGCATGGTTTGATGG + Intronic
1079180473 11:18189206-18189228 CCACCTCCAGGATGTTCTGCAGG - Exonic
1084791587 11:71478385-71478407 CCTTCTCCAGGAAGTCCTGACGG + Exonic
1084863541 11:72038398-72038420 TCACCACTAGGAACTCCTGAAGG + Intronic
1085058249 11:73420886-73420908 TTACCTTCATGGTGTCCTGAGGG + Intronic
1085130081 11:74030756-74030778 TCTCCTCCTGGATGTCCTACAGG + Intronic
1085715013 11:78864739-78864761 TTACATCCAGGGTGTCATGAGGG - Intronic
1086278630 11:85160641-85160663 TGAGCTCAAGGATGTCTTGACGG + Intronic
1086420702 11:86634355-86634377 TCACAACCAGGATGTCAGGAGGG - Intronic
1087045602 11:93841522-93841544 TCACCTCCAGGTGGTTCTAATGG - Intronic
1087904906 11:103684478-103684500 TGACCTCCAGGATGGACTGAGGG - Intergenic
1088497553 11:110446724-110446746 TCGCCTCCAGCATGTCCTGTTGG + Intronic
1089003224 11:115069209-115069231 CTACCTCCAGAATGTCCAGAGGG + Intergenic
1096552669 12:52383603-52383625 CCACCTGCAGGATGTCCTAGAGG - Exonic
1097315343 12:58165612-58165634 TCACATCCAGGGTGCACTGATGG - Intergenic
1098488876 12:71052045-71052067 TCAGTTCCAGGACCTCCTGAGGG - Intronic
1102050380 12:109857593-109857615 CCACCTCCAGGATGTTCTGCAGG + Exonic
1102469034 12:113149285-113149307 TCTCCACTAGGAGGTCCTGATGG + Intergenic
1102523257 12:113492544-113492566 TCACCTCCAGGCTATGCTGATGG - Intergenic
1102831072 12:116000341-116000363 TCACCTCCAGTCCGTCCTGGTGG - Intronic
1103641376 12:122355243-122355265 TGCCCTCCAGGAGGCCCTGAAGG - Exonic
1104411133 12:128558743-128558765 TTACCTACAGGTTGCCCTGAGGG - Intronic
1105728997 13:23192932-23192954 TCACCTCCAGGAAGACAGGAAGG - Intronic
1108581056 13:51828485-51828507 TCACCTCCAGGAAATGTTGATGG + Intergenic
1108880852 13:55113638-55113660 TCTCCTCCAGCATATCCTGTGGG + Intergenic
1111207864 13:85035664-85035686 TCACATCCAGGATATGCTGATGG - Intergenic
1113843750 13:113374552-113374574 GCACCTCCAGGTGGTCCTCAGGG + Intergenic
1118044171 14:61948613-61948635 TCTCTACCAGGATGTCCTGCAGG - Intergenic
1118235221 14:63996985-63997007 TCACCACATGGAAGTCCTGAGGG + Exonic
1118593691 14:67420014-67420036 TCACTTCCAGGTGGTTCTGAAGG + Intergenic
1119053009 14:71389177-71389199 TCCTCTGCAGGAAGTCCTGAGGG + Intronic
1119207838 14:72808031-72808053 TCACCCCCAGCCTGACCTGATGG + Intronic
1120881589 14:89418122-89418144 TCACCACCAGGGTGTCCTGTTGG - Intronic
1122340948 14:101028163-101028185 TCACCTCCAGGAAGTCCTCCTGG - Intergenic
1122623158 14:103071094-103071116 TCAGCTCCTGCAAGTCCTGATGG + Intergenic
1122796025 14:104206662-104206684 CCACCTCCAGCAGCTCCTGATGG + Intergenic
1124027843 15:25983252-25983274 ACAACCCCAGGAGGTCCTGATGG + Intergenic
1124952403 15:34336410-34336432 TCACCCCCAGGATGTCATCGAGG - Exonic
1124959176 15:34382224-34382246 TCTCCTCCAGGAGGTCCATAAGG + Exonic
1124975802 15:34528445-34528467 TCTCCTCCAGGAGGTCCATAAGG + Exonic
1127914155 15:63441768-63441790 TCATCACCAGGATGGCCTGAGGG - Intergenic
1128321698 15:66699125-66699147 TAACCTGCAGGACCTCCTGAGGG - Intergenic
1130870299 15:87966341-87966363 TGATCTTCAGGATGACCTGAAGG + Intronic
1131396363 15:92089738-92089760 TCACCACCAGGAAGTCTTGCTGG + Intronic
1132116177 15:99138039-99138061 TCCCCAGCAGGGTGTCCTGAGGG + Exonic
1132184578 15:99792201-99792223 TCTCCTCCAGGAGGTCCATAAGG - Intergenic
1132432401 15:101772455-101772477 TCTCCTCCAGGAGGTCCATAAGG + Intergenic
1135829011 16:25756652-25756674 TCACCGCAAGGATGTACTGTAGG - Intronic
1136230407 16:28882564-28882586 CCACCTCCACGATGTCCCCAGGG - Exonic
1136531225 16:30870802-30870824 TCAACTCCAGAATGTCCCTAAGG + Intronic
1138564262 16:57821298-57821320 TCTCCTCCAGGAAGTCCTCTTGG - Intronic
1138819933 16:60246731-60246753 TCACATCCTGGATATTCTGAAGG + Intergenic
1139175827 16:64686340-64686362 TTACCTCCTGGATGTCCCAAAGG + Intergenic
1140681869 16:77393128-77393150 TCACCTCCATGGTGACCAGATGG - Intronic
1142756254 17:2018183-2018205 TTCCCTCCAGGGTGACCTGATGG - Intronic
1142995779 17:3759481-3759503 TCACATCCTGGCTGTCCCGAAGG + Exonic
1143141628 17:4744618-4744640 ACACCTCCAGGCTGTCCTGAGGG - Exonic
1143278272 17:5730851-5730873 TCACCTCCTGGTTCTCCTGCTGG - Intergenic
1143790000 17:9287246-9287268 TCACCTGCAGGAGAACCTGATGG - Intronic
1144011591 17:11153459-11153481 CCACCTCCAGTGTGTTCTGAAGG - Intergenic
1144837443 17:18164082-18164104 TCACATTGAGCATGTCCTGAGGG - Intronic
1145905727 17:28515132-28515154 TCTCCTTGAGGATGTCCTCAGGG + Intronic
1146693752 17:34893607-34893629 TCCCCTCCAGGCTGCCCTAAGGG - Intergenic
1148754116 17:49963571-49963593 TCAACTCCAGGGGGTCCAGAGGG + Intergenic
1148978464 17:51550061-51550083 TGACCACTAGGATTTCCTGAGGG + Intergenic
1149550161 17:57533847-57533869 TCCCCTCCAGGATTTCCCCAGGG - Intronic
1149627842 17:58092408-58092430 TCTCCTCCAGGAAGCCCTGCAGG - Exonic
1149642917 17:58216162-58216184 CCAGCTTCAGGATCTCCTGACGG + Exonic
1152123754 17:78434205-78434227 ACATCTCCAGGGTGTCCTGTGGG + Exonic
1152832207 17:82504327-82504349 CCAGCTCCAGGAGCTCCTGAAGG + Intergenic
1153958077 18:10115202-10115224 TCACCAGCATGATTTCCTGAAGG + Intergenic
1155181878 18:23355036-23355058 TCACCTTCAGGAGGTTCTGGGGG - Intronic
1156495769 18:37524428-37524450 TTAACTCCAGGCTGTCTTGATGG + Intronic
1157773220 18:50369113-50369135 TCACCACCAGGCCTTCCTGAAGG - Intergenic
1157884820 18:51356872-51356894 TCACCCTCATGATGTCCTAAAGG - Intergenic
1158327265 18:56325396-56325418 CCACATCCAGGAGGGCCTGAGGG + Intergenic
1160905649 19:1450545-1450567 TCACCTCAGGGAGGTCCGGATGG - Intronic
1161559995 19:4967966-4967988 TCACCTCCAGGAAGAACTGCTGG + Intergenic
1165856297 19:38880882-38880904 CCACCTTCAGGAAGTCCTGCGGG + Exonic
1166048457 19:40243450-40243472 TCCCCTCCAGGGAGTCCTGCGGG - Intronic
1166179816 19:41100077-41100099 TCACCTGCATTATATCCTGAAGG - Intergenic
1166277116 19:41761754-41761776 TCATCTCCAGGATGTCCTTAAGG + Intronic
1166809369 19:45506681-45506703 TCACCTCCGGGCCCTCCTGAGGG + Intronic
1167198570 19:48048090-48048112 CCAGCTCCAGGATCTCCCGAGGG + Exonic
1167845633 19:52162064-52162086 TCTACTCCAGGATGTCTAGAAGG - Intronic
1168283970 19:55321344-55321366 GCATCTCCAGGAGGTCCTGGAGG - Intronic
1168613293 19:57818122-57818144 ACAGCTTCAGGAAGTCCTGACGG + Intronic
925742627 2:7019271-7019293 TCACCCACTGGGTGTCCTGACGG - Intronic
925913184 2:8586656-8586678 TCCCCTTCAGGATGTCCAGCTGG + Intergenic
930019900 2:46995201-46995223 TAAGCTCCAGGATGTCCTTCAGG + Intronic
934635605 2:95985883-95985905 TCAAGTCCAGAATGTCTTGATGG - Intronic
934798020 2:97119364-97119386 TCAAGTCCAGAATGTCTTGATGG + Intronic
934835402 2:97584074-97584096 TCAAGTCCAGAATGTCTTGATGG - Intronic
935345501 2:102104120-102104142 CCACCTCCAGGGTGTGGTGAAGG + Intronic
936971100 2:118177098-118177120 TCCCCTCCCTGCTGTCCTGATGG + Intergenic
939808688 2:146806152-146806174 TGACCTCAAGGATATCCTCAGGG - Intergenic
940051269 2:149467451-149467473 TGACTTCCAGGATGTGTTGAAGG + Intronic
940241188 2:151564765-151564787 TCACTTGCACGATCTCCTGAAGG + Intronic
942322726 2:174750098-174750120 TCAGCTCCACGATGACCAGAAGG + Exonic
944329771 2:198451965-198451987 TCCCCTCAAGCATGTCCTCAGGG + Intronic
946129947 2:217598916-217598938 ACACTTCCAAGTTGTCCTGAAGG - Intronic
1168835022 20:872256-872278 TCACCTCCAGCATGTCCTAGAGG - Exonic
1168967116 20:1905440-1905462 TCTGGGCCAGGATGTCCTGAGGG + Intronic
1169383387 20:5127463-5127485 TCACCTCCAGGAAGGCCTCACGG - Intronic
1170689107 20:18596111-18596133 TACCCTCCAGTGTGTCCTGAAGG + Exonic
1171287747 20:23955905-23955927 TCACCTGCAGGATGGACAGATGG + Intergenic
1173915719 20:46707551-46707573 TCACCTCCAGGCTAGGCTGAGGG + Intergenic
1175291816 20:57881102-57881124 TCACCTCTAGTCTGTCCTCAGGG + Intergenic
1175887010 20:62297814-62297836 CCATCTGCAGGAAGTCCTGATGG + Intergenic
1175964198 20:62652256-62652278 TGACCTCCAGGCAGTCCTCAGGG + Intronic
1176303980 21:5113982-5114004 TGACCTCCAGGCTCTCTTGAAGG - Intergenic
1178304255 21:31477735-31477757 TCATCTTCAGGATGTCCTCTGGG - Intronic
1178587284 21:33880923-33880945 TCACCTCCACTAGGTTCTGAAGG - Intronic
1179853050 21:44147968-44147990 TGACCTCCAGGCTCTCTTGAAGG + Intergenic
1180962590 22:19768689-19768711 CCACATCCAGGATGTGCGGAGGG + Intronic
1181668519 22:24414474-24414496 TCACCTCCAGGCTGTGCCAATGG - Intronic
1182583641 22:31330180-31330202 TCACCTTTAGGAAGTGCTGATGG + Intronic
1182943916 22:34304598-34304620 TCACTCTCAGGATATCCTGAAGG - Intergenic
1183541475 22:38431560-38431582 TAAGCTCCAGGATGTGCTGGGGG - Intronic
1183560802 22:38570743-38570765 TCACCTCCAGGTTTTCATGCTGG + Intergenic
1184986474 22:48139623-48139645 TGACCTCCAGGAAGACCAGATGG - Intergenic
1185256367 22:49835176-49835198 TCTCCTCCAGGATGTCCTGTAGG + Intergenic
1185333153 22:50260633-50260655 TCACCCCCAGGGGCTCCTGAGGG + Intronic
1185362127 22:50414671-50414693 TCACGTGCAGGACGTCCTGCCGG - Exonic
950704825 3:14773220-14773242 TAACCCCCAGGATGCCCAGATGG + Intergenic
951593686 3:24294254-24294276 CAACATCCAGGATGTCCTGGGGG - Intronic
951913355 3:27774177-27774199 TGACTTCCAGGTTTTCCTGAAGG + Intergenic
953768806 3:45763497-45763519 TCCTCTCTAGGAAGTCCTGATGG - Intronic
954423786 3:50432677-50432699 TCATGTCCAGGAGATCCTGAAGG + Intronic
955701232 3:61684287-61684309 TCCCCTCCAGGCTGTGCTGTCGG + Intronic
956546305 3:70407585-70407607 TCACATCCAGGTTATGCTGATGG + Intergenic
956703867 3:71982611-71982633 TCACCCCCAGCCTGCCCTGATGG - Intergenic
956969253 3:74503269-74503291 TCAACTTCAGTATTTCCTGATGG + Intronic
957495614 3:80987623-80987645 TCAACCCCAGGATGTCATGTTGG + Intergenic
958583976 3:96061946-96061968 TCACATCCAGGGTGTGCTGATGG - Intergenic
960334625 3:116401078-116401100 TCATATCCTGGATGTCCTGGAGG - Intronic
961047947 3:123722206-123722228 CCACATCCAGGATGCCCTGCCGG - Exonic
961270012 3:125681358-125681380 CCACATCCAGGATGCCCTGCCGG + Intergenic
961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG + Intronic
961909719 3:130302079-130302101 TCACCGCTAGGATGTCTTTAGGG + Intergenic
962908538 3:139826641-139826663 TCACCTCCCACATTTCCTGAGGG + Intergenic
963042977 3:141082813-141082835 TCCCTTTCAGAATGTCCTGAGGG + Intronic
967598133 3:191351867-191351889 ACAACTCCAGGATGGCCTGTGGG + Intronic
968688322 4:1976184-1976206 ACAGCTCCAGGATCTGCTGATGG - Intronic
968874039 4:3255875-3255897 GCACCTGCAGGATGTGCTGCTGG - Exonic
969509844 4:7611553-7611575 TCACCTTCAGGGGGCCCTGAAGG - Intronic
969513259 4:7631722-7631744 TCCCCTCCAGAATGGGCTGAGGG + Intronic
974746898 4:66088718-66088740 TGGGCTCCAGCATGTCCTGAAGG - Intergenic
976462981 4:85334389-85334411 TCACCTCCACTTTATCCTGAGGG + Intergenic
977295285 4:95202730-95202752 TGACACCCAGGATGCCCTGAAGG - Exonic
981752068 4:148102380-148102402 TTTCCTCCAGAATGTCCTAAAGG + Intronic
982440555 4:155431057-155431079 TAACCTCCAAAATGCCCTGAAGG + Intergenic
984441011 4:179770652-179770674 TCTCCAACAGGATTTCCTGATGG + Intergenic
986083152 5:4414937-4414959 TTGCCACCAGGATGTCCTGCTGG + Intergenic
986329216 5:6705104-6705126 TTACCTCCAGAATCTCCTGCGGG + Intergenic
986684727 5:10266627-10266649 GCAGTTCCAGGATGTCCTGTAGG + Intergenic
988707336 5:33739169-33739191 TCAGCTCCAGGATGTAAAGATGG - Intronic
991488634 5:67163568-67163590 TCACCTCCAGGCTGTGCTTGCGG - Exonic
991647414 5:68815089-68815111 TTACCTCCAGGAAGTCCAGCAGG - Intergenic
993045859 5:82865989-82866011 TCACCTTCATGAGGTGCTGATGG - Intergenic
997531127 5:134581839-134581861 CCACCTCCAGGATGTCCAGCAGG + Exonic
1000344628 5:160304469-160304491 TCATCTCCAGGGGGTCATGAGGG + Intronic
1002063197 5:176638743-176638765 TCACATCCTGGGTGTCCTGGAGG + Intronic
1002315085 5:178338288-178338310 TGATCTCCAGGAAGTCCAGAGGG + Intronic
1002420379 5:179143605-179143627 TCCCATCCAGGATGACCTCATGG - Intronic
1002894311 6:1367459-1367481 ACCCCTCCAGGCTGTCCTGTGGG + Intergenic
1004623880 6:17356592-17356614 TTACTTCAAGGATGTACTGATGG - Intergenic
1006276388 6:33008040-33008062 GCTCCACCAGGATGTCCAGATGG + Exonic
1006284223 6:33080841-33080863 TCTCCTCCAGGATGTCCTTCTGG - Exonic
1008117239 6:47566088-47566110 TCTTCTTCAAGATGTCCTGATGG + Intronic
1010663534 6:78599267-78599289 TCAGCACCAGGATTTCCTGTAGG + Intergenic
1011010189 6:82694976-82694998 TCCCCTCCAAGAGGTCCTGAAGG - Intergenic
1012054894 6:94393823-94393845 TCACCTCCAAGGGTTCCTGATGG - Intergenic
1012936983 6:105378547-105378569 TCACTACCAGTATTTCCTGATGG - Intronic
1013253516 6:108359529-108359551 TCATCTCAAGGATGCCTTGAAGG + Intronic
1019462692 7:1169423-1169445 CCACCTCCGGGACGTCCTGAAGG + Intergenic
1023336270 7:39174118-39174140 CCACCTCCAGGGTGAACTGAAGG - Intronic
1023496125 7:40799158-40799180 TCAGCTCCAGGATCTCTTCATGG - Intronic
1024435707 7:49352594-49352616 TCAGCTCCAGGATGTCTGTATGG + Intergenic
1024531116 7:50393415-50393437 TGACCTGCAGGATGACATGAAGG + Intronic
1025301402 7:57821812-57821834 TCGGCTCCAGGAGGTCCTGAGGG + Intergenic
1028896847 7:96050983-96051005 TCAGCTCCAGCATGTTTTGATGG - Intronic
1029919566 7:104248621-104248643 TCACCACCAGGTCTTCCTGAAGG + Intergenic
1030004592 7:105104712-105104734 TCATCTCCAGGAGATTCTGATGG + Intronic
1034401817 7:150866889-150866911 CCATCTCCAGGGTGTCCTGTCGG - Intergenic
1034423090 7:150999346-150999368 TCACCTCCAGGATGTTGTAGCGG - Exonic
1034842764 7:154414914-154414936 TCACTTCCAGTATGTTCTGCAGG + Intronic
1037963026 8:23113986-23114008 TAACAGTCAGGATGTCCTGATGG + Intronic
1038284405 8:26194031-26194053 TTACCTCTAGGATGGCCTCATGG - Intergenic
1040412360 8:47167400-47167422 TCCCGTCCAGCAAGTCCTGAGGG + Intergenic
1040518193 8:48151529-48151551 TCTCCTCAAGGATGGCCAGAAGG + Intergenic
1045186960 8:99848016-99848038 TCACAGCCAGGATTACCTGAGGG - Intronic
1045391916 8:101724374-101724396 TGGCCTCCTGGATGTCCTGTTGG + Intronic
1046486700 8:114896478-114896500 TCACTCCCAGTATTTCCTGAAGG + Intergenic
1047430800 8:124789822-124789844 CCACCTTCTGGATCTCCTGACGG + Intergenic
1049183221 8:141234271-141234293 TGACCTCCTTGAGGTCCTGACGG - Intronic
1050320603 9:4448401-4448423 ACAGCTCCAGTATCTCCTGATGG + Intergenic
1053510663 9:38685395-38685417 TGGCATCCAGAATGTCCTGAGGG - Intergenic
1055400979 9:75923775-75923797 TCTCCTCCAGAATCTCCTGAAGG - Intronic
1057206362 9:93175312-93175334 CCACATCCAGGGGGTCCTGAGGG + Intergenic
1060965933 9:127712331-127712353 TCACCTGCAGAATGTTCTGTAGG - Exonic
1061144332 9:128788340-128788362 AGATTTCCAGGATGTCCTGAAGG + Exonic
1062232987 9:135493021-135493043 CCGCCTCCAGGATGTCCCCAAGG + Intergenic
1189195540 X:39149121-39149143 TCACCTCCATGGTGATCTGAAGG - Intergenic
1192504465 X:71672549-71672571 CCACCTCCTTGATGTCCTGTAGG + Intergenic
1193509758 X:82384454-82384476 TCTCCTTCAGGATCTGCTGAGGG + Intergenic
1195349875 X:103985863-103985885 TCATCTCGAGGATGGCCTGTGGG - Intergenic
1195357568 X:104052976-104052998 TCATCTCGAGGATGGCCTGTGGG + Intergenic
1195627341 X:107017903-107017925 TGACCTCCATGATGTCTTGGTGG + Intergenic
1196803433 X:119563775-119563797 GCACCTGCAGGATTTCCTGATGG + Intronic
1197168893 X:123409513-123409535 TCAAGTCCATGATGTTCTGAAGG - Intronic
1197839517 X:130730600-130730622 ACAGCTTCAGGAGGTCCTGATGG + Intronic
1200706558 Y:6447834-6447856 TAACCACCACGATGGCCTGAAGG - Intergenic
1201027554 Y:9716874-9716896 TAACCACCACGATGGCCTGAAGG + Intergenic
1202276374 Y:23124883-23124905 CCACCTCCAGCATTTCATGAAGG + Intergenic
1202289654 Y:23295807-23295829 CCACCTCCAGCATTTCATGAAGG - Intergenic
1202429368 Y:24758608-24758630 CCACCTCCAGCATTTCATGAAGG + Intergenic
1202441423 Y:24911482-24911504 CCACCTCCAGCATTTCATGAAGG - Intergenic
1202585106 Y:26415349-26415371 TCAAGTCCAGAATGTCTTGATGG + Intergenic