ID: 1064191361

View in Genome Browser
Species Human (GRCh38)
Location 10:13208691-13208713
Sequence CCCCTTCCTCCTCTTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1025
Summary {0: 1, 1: 1, 2: 6, 3: 125, 4: 892}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064191361_1064191365 6 Left 1064191361 10:13208691-13208713 CCAAAAAAAAGAGGAGGAAGGGG 0: 1
1: 1
2: 6
3: 125
4: 892
Right 1064191365 10:13208720-13208742 ATAGATTATCCTGCACCAGAGGG No data
1064191361_1064191364 5 Left 1064191361 10:13208691-13208713 CCAAAAAAAAGAGGAGGAAGGGG 0: 1
1: 1
2: 6
3: 125
4: 892
Right 1064191364 10:13208719-13208741 CATAGATTATCCTGCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064191361 Original CRISPR CCCCTTCCTCCTCTTTTTTT TGG (reversed) Intronic
900548806 1:3243377-3243399 CTGCTTCCTCTTTTTTTTTTTGG - Intronic
901929966 1:12590913-12590935 TCCCTTCCACCTTTTTTTCTGGG + Intronic
901984500 1:13063545-13063567 TCTCTTTCTCTTCTTTTTTTGGG - Intronic
901997310 1:13163225-13163247 TCTCTTTCTCTTCTTTTTTTGGG + Intergenic
902108564 1:14058723-14058745 CCCCTTTCTGTTCTTTATTTTGG - Intergenic
902202826 1:14846404-14846426 CCCCTGCCTCCTCTCTGTTATGG - Intronic
902253040 1:15168344-15168366 CCCATTCCCCTTCTTTCTTTTGG - Intronic
902378181 1:16040029-16040051 CCTCTCTCTCCTCTTGTTTTAGG - Intergenic
902383288 1:16062534-16062556 CCTCTCTCTCCTCTTGTTTTAGG - Exonic
902577487 1:17387441-17387463 CCCCCTCCTTTTCTTTTTTGAGG - Intronic
902582355 1:17416067-17416089 CCCCCCCCCCCTTTTTTTTTTGG - Intronic
902682347 1:18052196-18052218 CCCTTTCTTCTTCTTTGTTTTGG + Intergenic
902886138 1:19406184-19406206 TCCCGCCCTCCTCCTTTTTTGGG - Intronic
903669715 1:25028226-25028248 CCCCTTCTTCCTCTTCTTTCTGG + Intergenic
903750526 1:25617866-25617888 CCTCTTCCTCCTCTTCCTCTCGG + Exonic
903860023 1:26359500-26359522 CTTCTTCTTCTTCTTTTTTTTGG + Intergenic
903907933 1:26698530-26698552 CCATTGCCTCCTCTTTTGTTTGG - Intronic
904146925 1:28400464-28400486 CACCTGGCTTCTCTTTTTTTTGG - Intronic
904256559 1:29258483-29258505 CCTCTTCCTCCTCTCTTTCCAGG + Exonic
904523679 1:31115622-31115644 CTTCTTTCTCCTTTTTTTTTTGG + Intergenic
904690908 1:32292595-32292617 TCCCTTCCTCATCTTTTCTGGGG + Intronic
905069308 1:35211232-35211254 CACCTCCCACCTCTTTTCTTGGG + Intergenic
905406115 1:37733516-37733538 GCCCTTGCTCCTCTTTTTGAGGG + Intronic
906238313 1:44225480-44225502 CCCTCTCCTCTTCTTTTTTGGGG + Intronic
906626778 1:47332131-47332153 CCCCATTCTCCTTTTTCTTTTGG - Intergenic
907293854 1:53436351-53436373 CCCCACTCCCCTCTTTTTTTTGG - Intergenic
907489845 1:54801741-54801763 CACCTCCCTCCTCTCTTTTTGGG + Intergenic
907790862 1:57662104-57662126 CCCCTTCCTCCACTTTTTTTGGG + Intronic
908319222 1:62964429-62964451 CACATTCCCCCTCTTTTTCTGGG - Intergenic
908712728 1:67035230-67035252 TGCCCTCCTCCTCTATTTTTTGG + Intronic
908864694 1:68533834-68533856 GTCCTTCCTCCTCAATTTTTTGG - Intergenic
909309301 1:74125885-74125907 TTCCTTACTCCTCTATTTTTGGG + Intronic
909362346 1:74778006-74778028 CCTCTTCCTCCTTTCTTCTTTGG + Intergenic
909616122 1:77610424-77610446 TTCCCTCCTCCTCTATTTTTTGG - Intronic
909898718 1:81107244-81107266 GCCCATCCTCCTCAATTTTTTGG + Intergenic
910046557 1:82924828-82924850 CTCCTTCCTGCTCTGATTTTAGG + Intergenic
910089272 1:83442828-83442850 TTCCTGCCTCCTCTTTTTTTGGG + Intergenic
910378945 1:86604866-86604888 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
910439139 1:87234350-87234372 CCCCTTTCTCCTCTTATTCCCGG - Intergenic
910563926 1:88622178-88622200 CCCCCTCCTCCTCAGTTTTTTGG - Intergenic
910784244 1:90977319-90977341 TCCCTTCATACTATTTTTTTAGG - Intronic
911087196 1:93988994-93989016 CCCCTTCCTCTTTTGCTTTTTGG + Intergenic
911844561 1:102734648-102734670 CACCTTCCTCCTGATTATTTTGG + Intergenic
912161303 1:106987852-106987874 CCCTTTGCTTCTATTTTTTTTGG - Intergenic
912670349 1:111619541-111619563 ACCCTTCCTCATCTTTTTTCCGG + Intronic
912816482 1:112832825-112832847 CACCTTCCTCCTCTTGCTTCTGG - Intergenic
913197826 1:116472659-116472681 CCCCTACTTACTCTTTTTCTTGG - Intergenic
913691190 1:121281433-121281455 CCTCTTCCTCTTCTTCTTTTTGG + Intronic
914146353 1:144998548-144998570 CCTCTTCCTCTTCTTCTTTTTGG - Intronic
914822804 1:151118034-151118056 CTGCTTCCTGCTCTTTCTTTAGG - Exonic
914926934 1:151896913-151896935 CCTCTTTCTCCTATATTTTTTGG - Intronic
915000787 1:152588199-152588221 GTCCTTCCTCCTCAATTTTTTGG - Intronic
915192591 1:154164161-154164183 CACTTTCCTACTCTTTTTTTGGG + Intronic
915399889 1:155614449-155614471 CTCCTTTCTCTACTTTTTTTTGG - Exonic
915417047 1:155750313-155750335 CTCCTTTCTCTACTTTTTTTTGG - Exonic
915696320 1:157746197-157746219 GCCCTTCCTCCTTGATTTTTTGG - Exonic
915775279 1:158477588-158477610 GACCTTTCTCCTCTTTTATTAGG - Intergenic
916426806 1:164688629-164688651 CCTCTTACACCTCTTTTTTAAGG + Intronic
916670174 1:167010362-167010384 CCCCTCCTTCATGTTTTTTTGGG + Intronic
916685564 1:167142497-167142519 TTCCTTCCTCTTCTGTTTTTAGG + Intergenic
916756179 1:167772114-167772136 CCTCTCTCTCCTCCTTTTTTCGG - Intronic
916909520 1:169330913-169330935 GTCCCTCCTCCTCTATTTTTTGG - Intronic
917151558 1:171950958-171950980 CCTCTTCCTCCTCCATTTTTTGG + Intronic
917583510 1:176400390-176400412 TTCCTTCCTCCTTTATTTTTTGG + Intergenic
917833566 1:178920429-178920451 CCTCTTGCTCCTCTTATTTCAGG + Intronic
918408673 1:184236072-184236094 CTCCTTCCACCTCTTTTGCTAGG - Intergenic
918515917 1:185362892-185362914 ATCCTTCCTCCTCAATTTTTTGG - Intergenic
918529438 1:185501958-185501980 CACCTTCCTCTTCTACTTTTAGG - Intergenic
918665871 1:187150337-187150359 TTCCCTCCTCCTCTGTTTTTTGG + Intergenic
919207801 1:194439463-194439485 CTCCCTCCTCCTCAATTTTTTGG - Intergenic
919311328 1:195913837-195913859 TCCCTGCCTCCACTTCTTTTGGG + Intergenic
919337016 1:196248756-196248778 TTCCTTCCTCTTCTATTTTTTGG - Intronic
919773950 1:201181519-201181541 CCTCTTCTTCTTCTTTTTTTAGG + Intergenic
919914074 1:202129396-202129418 CTCCTTCCTCCTCCTTTCTTTGG + Exonic
920092484 1:203464378-203464400 ACCCTCCCTCCTGTTTTTTCTGG - Intergenic
920478514 1:206299909-206299931 CCTCTTCCTCTTCTTCTTTTTGG + Intronic
920624672 1:207585469-207585491 CCTTTTCCTACTCTTTTCTTTGG - Intronic
920700344 1:208213578-208213600 CCCCTTCTTCCTCTCTTTTCTGG + Intronic
920728882 1:208463801-208463823 CCTCTGCCTCCTCTTTTTTCAGG - Intergenic
920955800 1:210619277-210619299 CCCATTCTTCCTCTTTCTTCTGG + Intronic
921458057 1:215395414-215395436 CCAACTCCTCCTCATTTTTTAGG + Intergenic
921657450 1:217757580-217757602 CCCATTCCTCATGTTTTTATGGG - Intronic
921955623 1:220980565-220980587 CCTTTTCCTCCTCTGTATTTTGG + Intergenic
922012159 1:221599656-221599678 CTCCTTCCTTTTCTTTTTATAGG - Intergenic
922026969 1:221759140-221759162 CACCTTCTCCCTCTTTTTATAGG + Intergenic
922217401 1:223531515-223531537 CCCATTCCTCCACGTTTTTCAGG + Intergenic
922476859 1:225912369-225912391 CCCCATCCCCCCCTGTTTTTTGG + Intronic
923636338 1:235700952-235700974 TCCCTTCCCCTTCTTTGTTTTGG - Intronic
924202646 1:241675312-241675334 TCCCTTCCTTTTCTCTTTTTTGG + Intronic
924458058 1:244233960-244233982 CCTCTTCCTCCTCCTCCTTTGGG - Intergenic
924832238 1:247609316-247609338 CTCCCTCCTCCTCTATTTGTTGG - Intergenic
1063237163 10:4129049-4129071 CACATTCCTCCTCTTACTTTCGG + Intergenic
1063624187 10:7674012-7674034 CCTCTTCCTCTTCTTTTTGATGG + Intergenic
1063880841 10:10530213-10530235 CTCATTCCTCCTCTTACTTTTGG - Intergenic
1063973520 10:11397605-11397627 CCCCTTTCTGCTCTGATTTTGGG - Intergenic
1064191361 10:13208691-13208713 CCCCTTCCTCCTCTTTTTTTTGG - Intronic
1064257256 10:13753192-13753214 TTTCTTCCTCCTCCTTTTTTTGG + Intronic
1064696486 10:17971368-17971390 CTCCCTCCTCCTCTATTTTTTGG + Intronic
1064788163 10:18922553-18922575 CCTCTCTCTGCTCTTTTTTTAGG + Intergenic
1064803043 10:19097947-19097969 CGCGTTCCTCCTCTTACTTTCGG + Intronic
1065059645 10:21886437-21886459 GTCCTTCCTCCTCAGTTTTTTGG - Intronic
1065381164 10:25091910-25091932 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
1065446385 10:25805868-25805890 CGCCTTCCTCCTCTTACTTTCGG - Intergenic
1065499990 10:26370727-26370749 GTCCCTCCTCCTCATTTTTTTGG + Intergenic
1065504663 10:26417453-26417475 CCCCTTCATCTTCTTTTCATTGG - Intergenic
1065747985 10:28859293-28859315 CTTCTTCTTCTTCTTTTTTTTGG + Intronic
1065905488 10:30247601-30247623 CTCCTTGCTCCTCTTTACTTTGG + Intergenic
1065906972 10:30263931-30263953 TTCCTTCCTCCTCTATTTTTTGG - Intergenic
1066753034 10:38679200-38679222 ATCCTTCCTCCTCATTTTTTCGG - Intergenic
1067302850 10:45028963-45028985 TTCCTTTCTTCTCTTTTTTTGGG + Intergenic
1068055756 10:52011463-52011485 TCCCCTCCGCCTCCTTTTTTTGG + Intronic
1068306497 10:55216441-55216463 TCCATTCCTCCACTTCTTTTTGG - Intronic
1068366981 10:56064437-56064459 CTTCTTCCACCTCTGTTTTTTGG + Intergenic
1068844027 10:61650448-61650470 TTCCCTCCTCCTCTGTTTTTTGG + Intergenic
1068994098 10:63182740-63182762 CCCCTTCTTCCTCTTTTTACTGG + Intronic
1069277808 10:66614252-66614274 CCCCTTCCTTCTTTGTTTTCTGG - Intronic
1069335478 10:67344381-67344403 TTCCCTCCTCCTCTATTTTTTGG + Intronic
1069344737 10:67455468-67455490 CCCCTTCCTACTCTCCTGTTTGG - Intronic
1069614376 10:69797687-69797709 CCACCTCCTTCCCTTTTTTTTGG - Intergenic
1070117380 10:73541969-73541991 CCCATCCCTCCCCTTTTCTTAGG - Intronic
1070434730 10:76379260-76379282 GTCCTTCCTCCTCAATTTTTTGG + Intronic
1070516251 10:77210021-77210043 GCCCTTCCTCCTCAGTGTTTTGG - Intronic
1070990676 10:80729596-80729618 CCTCTTCTTCCTCTGTTTTAAGG - Intergenic
1071011100 10:80941568-80941590 TGCCTTCCTCCTCTGCTTTTAGG - Intergenic
1071108990 10:82132606-82132628 CCTCCTCCTCCTCTAATTTTTGG + Intronic
1071605960 10:86989973-86989995 CTCCTCCCTCCTCTATTTTTTGG + Intergenic
1071667560 10:87575909-87575931 TCCCCTCCTCCTCTATTTTTTGG + Intergenic
1072368529 10:94740407-94740429 ATCCCTCCTCCTCATTTTTTGGG + Intronic
1072515360 10:96176326-96176348 CCCTTTTCTCCTCCTTTTCTGGG - Intronic
1073294462 10:102430638-102430660 TCCCTCCCTCCTCCTGTTTTTGG + Intronic
1073384643 10:103114729-103114751 CCACTTCCTCCGTTTTTTCTTGG - Intronic
1073404012 10:103281079-103281101 CCCCTTCCTGCTATTTAATTAGG - Intronic
1073519495 10:104113788-104113810 TCACTTCCTCTTCTTATTTTGGG + Intergenic
1073533159 10:104251942-104251964 CGCCTTCGTCCTCTTACTTTCGG + Intronic
1074186141 10:111100920-111100942 CTGGTTCCTCCTCTTTTTCTTGG - Intergenic
1074981725 10:118625370-118625392 CACATTCCTCCTCTTACTTTCGG + Intergenic
1075196914 10:120367868-120367890 CTGCTTCCTCCTCTATTCTTAGG + Intergenic
1075441277 10:122480995-122481017 CTCTCTCCTCCTCTATTTTTTGG + Intronic
1075551284 10:123394578-123394600 CCAATTCCTCCTCATTTTTTGGG - Intergenic
1075559569 10:123458709-123458731 TCTCTTCCTCCTCTTGCTTTGGG + Intergenic
1076036178 10:127200277-127200299 CGCATTCCTCCTCTTACTTTTGG - Intronic
1076276675 10:129205292-129205314 GCCCTTCCCCCTATTGTTTTGGG + Intergenic
1076441401 10:130483623-130483645 CCCCTTCCCCCTGGTGTTTTGGG + Intergenic
1076653492 10:132005980-132006002 CACATTCCTCCTCTTACTTTTGG + Intergenic
1076654742 10:132016450-132016472 CACATTCCTCCTCTTACTTTTGG + Intergenic
1076826327 10:132971418-132971440 CTCCCTCCTTTTCTTTTTTTGGG + Intergenic
1077195615 11:1278608-1278630 CCCCTGCCTCCTCTGCTTCTCGG + Intronic
1077201698 11:1310615-1310637 CGCCTTCCTCCTCGTGCTTTTGG + Intergenic
1077523599 11:3050699-3050721 CCACCTGCTGCTCTTTTTTTAGG + Intronic
1077872659 11:6275595-6275617 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1078295121 11:10060489-10060511 GTCCTTCCTCCTCAATTTTTGGG - Intronic
1078517000 11:12031122-12031144 CCTCATCCTCCTCCTCTTTTGGG - Intergenic
1078692686 11:13597778-13597800 CCTCTCCCTTCTCTTTCTTTGGG - Intergenic
1078989275 11:16629627-16629649 GTCCTTCCTCCTCCATTTTTGGG + Intronic
1079183910 11:18219615-18219637 CCTCCTCCTCCTCTATATTTTGG - Intronic
1079503372 11:21127569-21127591 CCTCTTCCTCTTCTTCTTCTCGG - Intronic
1079687239 11:23374964-23374986 TTCCTTCCTCCTTTATTTTTTGG - Intergenic
1079796360 11:24807813-24807835 GACCTTCCTCCACTTTTTTATGG - Intronic
1080216936 11:29854419-29854441 GTCCTTCCTCCTCAATTTTTTGG - Intergenic
1080415685 11:32067952-32067974 ACCCTGCCTCTCCTTTTTTTAGG - Intronic
1080446513 11:32342856-32342878 CTCCTGCCTCCTCTCTGTTTGGG + Intergenic
1080601501 11:33825145-33825167 TTCCTTTCTCCTCTATTTTTTGG + Intergenic
1081106915 11:39081620-39081642 CCATTTTCTCCCCTTTTTTTGGG + Intergenic
1081211397 11:40339040-40339062 CCTTTTCCTCCTCTTTATTAAGG + Intronic
1081787463 11:45757473-45757495 CCCCTTCCTTCTCTTCTCTTTGG - Intergenic
1082064230 11:47886098-47886120 CCCCTTCTTCCTCTTTCTAAAGG + Intergenic
1083136498 11:60682619-60682641 TTTATTCCTCCTCTTTTTTTTGG - Intergenic
1083484811 11:62976710-62976732 CCTCTTCCTCCTCCTTGTGTGGG + Exonic
1083672588 11:64307326-64307348 CCCCATCCTCCTCTTCCTTGTGG - Exonic
1083875217 11:65519674-65519696 CCTCTTCCTCTTCCATTTTTTGG + Intergenic
1084226142 11:67715828-67715850 CACCTTCATCCTCTTTTTCTGGG - Intergenic
1084263981 11:67995707-67995729 CACCTTCATCCTCTTTTTCTGGG - Exonic
1084693822 11:70742226-70742248 CCCCTTCCTCCTCCTTCTGCTGG + Intronic
1084809433 11:71603416-71603438 CACCTTCATCCCCTTTTTCTGGG + Intergenic
1085257757 11:75185748-75185770 CGCGTTCCTCCTCTTACTTTCGG - Intronic
1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG + Intergenic
1085571671 11:77564253-77564275 TTCCTGCCTCCTCTATTTTTTGG + Intronic
1085984784 11:81772392-81772414 TCCCCTCCCCCACTTTTTTTTGG + Intergenic
1086990793 11:93302143-93302165 CCTCCTCCTCCTCCGTTTTTTGG - Intergenic
1087251685 11:95907476-95907498 GTCCTTCCTCCTCATTTTTTTGG - Intronic
1087367524 11:97239736-97239758 CCCCTTCCTCCACATTTTGAGGG - Intergenic
1087814763 11:102646620-102646642 TCCCTTCCCCCCTTTTTTTTGGG + Intergenic
1087889270 11:103518183-103518205 CACCTTCTCCCTCTTTTTCTTGG - Intergenic
1088395923 11:109369535-109369557 CCCCTTCTTTCTCTTTTTCTGGG + Intergenic
1088450389 11:109975546-109975568 ACACTTCCTCTTCTTTCTTTTGG + Intergenic
1088489657 11:110374483-110374505 CTCCTTCCTCCTTTTTTCTTTGG + Intergenic
1088593382 11:111422143-111422165 CCCCTGCATCCTTTTGTTTTGGG - Intronic
1088639546 11:111858233-111858255 CCTCTCCTTCCTGTTTTTTTAGG + Intronic
1088803500 11:113329481-113329503 CTCCTTCCTTCTCATTTTATTGG - Intronic
1088816890 11:113427492-113427514 CTCATTCCTCCTCTTGTTCTTGG + Intronic
1089345130 11:117786135-117786157 CCCCCTCCTCTTCTTTCTTTCGG - Intronic
1089355300 11:117846828-117846850 CCCTCTCCTCCTCTTTCTTCAGG + Intronic
1089717618 11:120377631-120377653 AGCCTTTCTTCTCTTTTTTTAGG + Intronic
1090178983 11:124676886-124676908 CCCCTTCCAACTTTTATTTTAGG - Intronic
1090317950 11:125813353-125813375 TTCCATCCTCCTCTATTTTTGGG + Intergenic
1091016370 11:132054674-132054696 CCCCTCCTTTCTCTTTCTTTGGG - Intronic
1091326753 11:134696496-134696518 CCTCATCCTACTCTTGTTTTAGG - Intergenic
1091393358 12:139067-139089 CCTCTTCCTCCTCTGTTTTGGGG - Exonic
1091990858 12:4954808-4954830 CCACTTCCTCATCTTTATTTGGG - Intergenic
1092162403 12:6323065-6323087 GAACTTTCTCCTCTTTTTTTTGG + Intronic
1092656745 12:10693537-10693559 TTCCTTCCTCTTCTGTTTTTTGG - Intergenic
1093087714 12:14885418-14885440 CCCCTGCATCCTCATTTTTAAGG - Intronic
1093500438 12:19806059-19806081 CCTCCTCCCCTTCTTTTTTTTGG + Intergenic
1093529331 12:20142096-20142118 CTCATGCCTCCTCTTTTCTTAGG + Intergenic
1093569818 12:20654135-20654157 CTTCTTCCTCCTCTTCTTCTGGG - Exonic
1094016266 12:25867793-25867815 TCTCTTTCTCCTCTTTTTCTGGG - Intergenic
1094328255 12:29263916-29263938 TTCCTTCCTCCTCTATTTTTTGG - Intronic
1095212972 12:39515148-39515170 GCCCCTCCTTCTCTATTTTTTGG - Intergenic
1095664581 12:44781433-44781455 CTCCTTTCTCCTCTCTTTCTCGG - Intronic
1096017731 12:48293797-48293819 CCCCTTCCTCTTGTTTCTTAGGG - Intergenic
1096365904 12:51027906-51027928 CCCCCCCCCCCACTTTTTTTTGG - Intronic
1096518912 12:52173304-52173326 CCCCTTCCACCTCCCTTTCTGGG + Intronic
1096640042 12:52987107-52987129 CCCCTTCAACTTCTTATTTTTGG + Intergenic
1096836284 12:54353350-54353372 CCCCTTCCTCCCCTTTGGCTGGG + Intergenic
1097234337 12:57529203-57529225 CAGTTTCCTCCTCTTGTTTTTGG - Exonic
1097841170 12:64322868-64322890 CCTCTTCACCCTCCTTTTTTTGG + Intronic
1097913722 12:64997989-64998011 CCCCTTCCTCCTGTTCTCTCTGG + Intergenic
1098212787 12:68184215-68184237 CCATTTCCTCCTGTTTCTTTTGG + Intergenic
1098492173 12:71094198-71094220 ACCCTCCCCCTTCTTTTTTTGGG - Intronic
1098732653 12:74058841-74058863 CCCCTTCATCATTTTTTATTGGG - Intergenic
1098743435 12:74204100-74204122 CACATTCCTTCCCTTTTTTTGGG + Intergenic
1099489794 12:83274272-83274294 CCCCTTTCTCATTTTTTATTGGG + Intergenic
1099645235 12:85344600-85344622 CTCCATCTTCCTCTTCTTTTAGG - Intergenic
1099808551 12:87550915-87550937 TTTCTTCCTCCTCTATTTTTTGG - Intergenic
1100577189 12:95903920-95903942 CCTCTTCTTACTCATTTTTTTGG + Intronic
1100637713 12:96450894-96450916 ATCCTTCCTCTTCTGTTTTTTGG - Intergenic
1101026148 12:100608898-100608920 CTCTTTCTTCCTCTTTTTCTGGG + Intronic
1101120452 12:101573985-101574007 CCCCTGCTTCATCTTTTCTTAGG - Intronic
1101219696 12:102625774-102625796 CCCCTCCCTTCCCTTTTTTGAGG + Intergenic
1101523642 12:105507586-105507608 CCCCCTCCTCCTTTCTTTCTGGG + Intergenic
1102716253 12:114975641-114975663 TCTCTTCCTCCTCTGTTTTAGGG + Intergenic
1102806042 12:115781966-115781988 TCTCTGCCTCCTCTTGTTTTTGG + Intergenic
1103169860 12:118808010-118808032 CTTCTTCCTCCTCTATTTTTTGG + Intergenic
1103629780 12:122250916-122250938 CCCGTTCCTCCTCCCTTTTGGGG + Intronic
1104102792 12:125630170-125630192 TTCCCTCCTCCTCTGTTTTTTGG + Intronic
1104405857 12:128516124-128516146 ACCCTTCCTCCTCTTTTCACTGG + Intronic
1104507243 12:129344066-129344088 CGCCTTCCTCCTCTTACTTTCGG + Intronic
1104671638 12:130684817-130684839 CACCTTCCTTCTCTTACTTTCGG + Intronic
1105284256 13:18992017-18992039 GGCCTTCCTGCTCTTTCTTTTGG - Intergenic
1105299772 13:19121818-19121840 TTCCTTCCTCTTCATTTTTTGGG + Intergenic
1105344577 13:19561090-19561112 CCCCATCCTCCTCTTCCTTGTGG + Intergenic
1105392403 13:19992568-19992590 CCCTTACCTCATCTTTTTTGGGG - Intronic
1105642555 13:22280693-22280715 CACCTTCCTCTTCCTTTTTTTGG - Intergenic
1106727881 13:32504879-32504901 CCCCTTCTTTCTGATTTTTTTGG - Intronic
1106979813 13:35265594-35265616 TCCCTACCTCCACTGTTTTTAGG - Intronic
1107643324 13:42467709-42467731 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1107709098 13:43134844-43134866 CTCCTTCCTCCCTTTTTTCTTGG - Intergenic
1107712523 13:43164290-43164312 CCCTCTCCTCCTCTCTTTTCTGG + Intergenic
1107807516 13:44168149-44168171 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
1107894326 13:44945466-44945488 CTATTTCCTCCTCTTTTTTAAGG - Intronic
1108537229 13:51396609-51396631 TTCTTTCTTCCTCTTTTTTTTGG - Intronic
1109317068 13:60762475-60762497 GTCCTTCCTCCTCAGTTTTTTGG + Intergenic
1109747985 13:66651620-66651642 TTCCTTCCTCATCTATTTTTTGG - Intronic
1109866111 13:68266300-68266322 TCCCATCCTTCTCTTTTTCTTGG + Intergenic
1110377656 13:74812525-74812547 TTCCTTCCTTCTCTATTTTTTGG - Intergenic
1110409432 13:75187589-75187611 TCCCTTCTTCCACTTGTTTTGGG - Intergenic
1110448723 13:75617629-75617651 CACTTTCCTCCCCTTTTTATAGG + Intergenic
1110618551 13:77569510-77569532 AAGCTTCCTCCTCTTTTTTGTGG + Intronic
1110742444 13:79013624-79013646 CCCCCTCATCCTCAATTTTTTGG + Intergenic
1111303052 13:86369652-86369674 CTCCATCCTCCTTTATTTTTTGG + Intergenic
1111511070 13:89263292-89263314 TCCCATCCTCCTCTGTTGTTTGG + Intergenic
1111519945 13:89387816-89387838 TCCCTTTCTCCTATTTTTTCTGG + Intergenic
1111722155 13:91959502-91959524 TTCCTTCCTCCTCATGTTTTTGG - Intronic
1111969773 13:94899975-94899997 TCCCTTCAACCTCTTTTATTAGG + Intergenic
1111992477 13:95130945-95130967 CTCCTTCTTCTTCTTTTTCTAGG + Intronic
1112047489 13:95612973-95612995 ACCATTCCCCCTCTTTTTCTCGG - Intronic
1112329942 13:98469543-98469565 CCCCCGCCGCCTTTTTTTTTTGG - Intronic
1114093855 14:19313146-19313168 TTCCTCCCTCCTCTATTTTTTGG - Intergenic
1114395848 14:22359970-22359992 GCCCTTCCTCCTTGGTTTTTTGG + Intergenic
1114561945 14:23599407-23599429 CCCTTTCACCCTTTTTTTTTTGG + Intergenic
1114687733 14:24549746-24549768 TTCCCTCCTCCTCTATTTTTAGG + Intergenic
1114782136 14:25549654-25549676 CCCCTTCTTAGTCTTGTTTTTGG + Intergenic
1115320094 14:32070544-32070566 CCCCCTCCTACTCTTACTTTAGG - Intergenic
1115398305 14:32933567-32933589 CCACTTCCTCCTCTTTCTTCCGG - Intergenic
1116077956 14:40136085-40136107 GTCCTTCCTCCTCATTTTTGTGG + Intergenic
1116330533 14:43592110-43592132 TCCCATCCATCTCTTTTTTTAGG + Intergenic
1116393497 14:44421328-44421350 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1116593628 14:46811474-46811496 CTGCTTCCTCTTCTTATTTTTGG + Intergenic
1116724710 14:48548078-48548100 ATCCTTCCTCCTCTAATTTTTGG - Intergenic
1116882218 14:50182606-50182628 AACCTTCCTTCTCTTTTTTCAGG - Exonic
1117315725 14:54568463-54568485 TTCCTTCCTCCTCCTTCTTTTGG + Intronic
1117369249 14:55061153-55061175 ACATTTCCTCGTCTTTTTTTTGG - Intronic
1117393113 14:55281545-55281567 ACCCTTCCTCTTCATTTTCTGGG + Intronic
1117821442 14:59654124-59654146 GCCCCTCCTCCTCTTCTTTGTGG - Intronic
1118215702 14:63806505-63806527 GTCCCTCCTCCTCTCTTTTTTGG + Intergenic
1118374216 14:65162840-65162862 CACATTCCTCCTCCTTTTCTGGG + Intergenic
1118615299 14:67571020-67571042 CCCCTACCTCCTCCTTCTATAGG + Intronic
1118798128 14:69163455-69163477 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1118822008 14:69351892-69351914 CCCCCTCCTCCTTTCTTTTTAGG - Intronic
1119611512 14:76067042-76067064 GCCCTTCCTTCTCTTTCTTTCGG + Intronic
1119800022 14:77435679-77435701 CCCCTTCCTCCATTGTTTTTAGG - Intronic
1120421624 14:84293207-84293229 CTCCTTACTCCTCCCTTTTTTGG + Intergenic
1120540215 14:85741812-85741834 CCCCTTCCATCTATTTTTCTAGG - Intergenic
1121348027 14:93150523-93150545 CCCCTTCTCCCTTTTTTTCTGGG + Intergenic
1122097543 14:99382514-99382536 CTCCTTCCTCCTGTTCTTTGAGG + Intergenic
1122868609 14:104622761-104622783 CGCGTTCCTCCTCTTACTTTCGG + Intergenic
1123111721 14:105872758-105872780 TTCCTTCCACCTCTATTTTTTGG + Intergenic
1123126501 14:105950414-105950436 CAACTTCCAGCTCTTTTTTTCGG - Intergenic
1202868447 14_GL000225v1_random:137339-137361 CCCCTTCCTCTTCGTTTCTCCGG - Intergenic
1123409078 15:20043822-20043844 CCCCCTCCTTCTCTCTTTCTGGG - Intergenic
1123518409 15:21050530-21050552 CCCCCTCCTTCTCTCTTTCTGGG - Intergenic
1123778551 15:23603725-23603747 CTCATTCCTCCTCTTCTCTTTGG - Intronic
1123780740 15:23625176-23625198 GTCCCTCCTCCTCTATTTTTTGG + Intronic
1125513859 15:40307279-40307301 CACTTTCCTCCTCTTCTCTTGGG + Intronic
1125737051 15:41934148-41934170 CCCCTTCTTTCACTTGTTTTGGG + Intronic
1126516801 15:49548556-49548578 TTCCCTCCTCCTCTCTTTTTTGG + Intronic
1126534319 15:49744214-49744236 GTCCCTCCTCCTCTATTTTTTGG - Intergenic
1127406486 15:58653744-58653766 TTCCCTCCTCCTCTATTTTTTGG + Intronic
1127484948 15:59410296-59410318 CTTCTTCTTCTTCTTTTTTTTGG - Intronic
1127780595 15:62310754-62310776 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1129411877 15:75354780-75354802 CCCCTTCCTCCTCCCCTTCTTGG - Exonic
1129546109 15:76397355-76397377 TTCCCTCCTCCTCTATTTTTTGG + Intronic
1129596576 15:76969033-76969055 CGCCTTCCTCCTCTTACTTTCGG - Intergenic
1129791630 15:78344560-78344582 ACACTTCCTCCCCTTTTTTTAGG + Intronic
1129902986 15:79166009-79166031 ACCCTTCTTCCTCTTTACTTGGG - Intergenic
1130962347 15:88669626-88669648 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1131856009 15:96595494-96595516 CTCCATCCTCTTCATTTTTTAGG - Intergenic
1132012224 15:98286164-98286186 CTTCTTCTTCTTCTTTTTTTTGG - Intergenic
1132100362 15:99018675-99018697 CCCCTCCCTGATCTTTTTCTGGG - Intergenic
1132385869 15:101399485-101399507 CCCCTCACCCCTCTCTTTTTGGG - Intronic
1132468791 16:90253-90275 CCTCTGCCTCCTCTCTTCTTTGG + Intronic
1133415151 16:5600760-5600782 CCTCTTCTTCCTCTTCTTCTTGG - Intergenic
1133473302 16:6096256-6096278 TCCTTTTCTCCTCTTTTCTTTGG - Intronic
1133945526 16:10344724-10344746 CACCTTCCTTCTCTTGCTTTTGG - Intronic
1134060023 16:11193786-11193808 CTTCTTCCTCCTCTTCTTTTTGG + Intergenic
1134268269 16:12710453-12710475 CCCCCTCCTTTTTTTTTTTTTGG - Intronic
1134381741 16:13733704-13733726 AGCCTTCCTCCTCATTTTTCAGG + Intergenic
1136078581 16:27836459-27836481 CCTCTTCCTCCTTTTCTTCTGGG + Intronic
1136330273 16:29571234-29571256 CCCCCCCCCCCTTTTTTTTTTGG - Intergenic
1138142950 16:54584014-54584036 CGCGTTCCTCCTCTTACTTTAGG - Intergenic
1138301909 16:55937540-55937562 CCCCATCCCCATGTTTTTTTTGG - Intronic
1138920444 16:61522136-61522158 CCCCTTATTCCTCTTCTTTTTGG - Intergenic
1139125758 16:64074849-64074871 CTCCTTCTTCCACTTTGTTTTGG - Intergenic
1139301037 16:65945561-65945583 CTCTTCCCTACTCTTTTTTTTGG - Intergenic
1139841050 16:69880971-69880993 CCAATTCCTGATCTTTTTTTTGG + Intronic
1139926822 16:70492963-70492985 CCCCATGCTACTTTTTTTTTTGG - Intronic
1140410540 16:74738174-74738196 CCCCTTCCTCCTGTGTCTCTGGG - Intronic
1140595305 16:76402075-76402097 GTCCTTCCTCCTCAGTTTTTTGG + Intronic
1141110458 16:81267165-81267187 CGCCTTCCTCCTCTTTTATCAGG - Intronic
1141688625 16:85584230-85584252 CCCCTGGCTCCCCTCTTTTTGGG + Intergenic
1141773094 16:86102850-86102872 CCCCTTGCTCCTTCTGTTTTTGG - Intergenic
1141963027 16:87421929-87421951 CCCTTTATTCCTTTTTTTTTTGG - Intronic
1142254983 16:89009367-89009389 CTCCTTGCTCCTCTTTTCCTCGG + Intergenic
1203141378 16_KI270728v1_random:1769338-1769360 CGCGTTCCTCCTCTTACTTTTGG + Intergenic
1142617864 17:1147014-1147036 CCCCATCCTCCTGTCTTTCTGGG + Intronic
1142688756 17:1592430-1592452 GTTCTTCCTCCTCCTTTTTTTGG - Intronic
1143093036 17:4460884-4460906 TTCCTTCCTCTTCTGTTTTTTGG + Intronic
1143257336 17:5570699-5570721 TCCCCTCCTCCTCAATTTTTTGG - Intronic
1143417401 17:6759763-6759785 CCCCTTCCTCTCCTTTTCTCAGG - Intronic
1143935460 17:10479791-10479813 TCCCTCCCTCCTTTCTTTTTTGG - Intergenic
1143965568 17:10754482-10754504 CCCCTTCCTCCTCTTCCATCTGG + Intergenic
1144338496 17:14293942-14293964 CCCCCTCCACTTGTTTTTTTGGG - Intergenic
1144935905 17:18898840-18898862 CGTCTTTCTCCTCTTTTTCTGGG + Intronic
1146672318 17:34749540-34749562 ACTCTTTCTCCTCTTTTTCTGGG + Intergenic
1148704975 17:49622112-49622134 GCCCTTCATCCTGTTTTTTCAGG - Intronic
1149147161 17:53508276-53508298 CTCCTTCCTCCTCTGTTTTTTGG - Intergenic
1149180379 17:53929476-53929498 TTCCTTCCTCCTCTATTTTTCGG + Intergenic
1149231509 17:54539928-54539950 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1149411649 17:56414341-56414363 ACCCATCCTCCTGTATTTTTTGG - Intronic
1150271231 17:63866721-63866743 CCCCTTCTTCCCTCTTTTTTTGG - Intergenic
1150357898 17:64504156-64504178 CACCTACCCCCTCTTTTTCTTGG - Intronic
1150541671 17:66106752-66106774 TTCCTTCCTCCTCTGTTTTTTGG - Intronic
1150664837 17:67123875-67123897 CCCCACCCTCCTCTTTCTTGTGG + Intronic
1150983996 17:70174914-70174936 CCCATCTCTCCTCATTTTTTTGG + Exonic
1151180062 17:72320830-72320852 CCCCTCCTTCCTCTGCTTTTGGG - Intergenic
1151240072 17:72750485-72750507 TCCTTTCCTCCAGTTTTTTTAGG - Intronic
1151888063 17:76934912-76934934 CTCCTTCCTCCTCTGCTTCTCGG - Intronic
1152322390 17:79615098-79615120 CTCGTTCCTGCTCTTTTTTATGG - Intergenic
1152909708 17:82994654-82994676 TTCCTTCCTCCTCTATTTTTTGG - Intronic
1153462161 18:5347808-5347830 GTCCCTCCTCCTCATTTTTTTGG - Intergenic
1153682384 18:7512832-7512854 CCCCTCCCTTCTCTTTCATTTGG + Intergenic
1154282640 18:13019233-13019255 CCCCTTATTCCTTTTTTTATAGG - Intronic
1154467917 18:14667866-14667888 GCCTTGCCTCCTCTTTTATTTGG + Intergenic
1154469882 18:14689909-14689931 GTCTTTCCTCCTCCTTTTTTTGG + Intergenic
1154932165 18:21011117-21011139 CCCCTACCACCTCTTTTGATTGG + Intronic
1155463524 18:26110218-26110240 GTCCTTCCTCCTCAATTTTTTGG + Intergenic
1156209201 18:34920375-34920397 CCTCCTCCACCCCTTTTTTTTGG - Intergenic
1156999375 18:43506459-43506481 TCCCTTCTTCCTCAATTTTTTGG + Intergenic
1157023328 18:43813354-43813376 TCCCTTCAACCTCTTTTTTAAGG + Intergenic
1157204480 18:45687077-45687099 CCCCCTGCTCCTCTTTTCTAGGG - Intergenic
1157463001 18:47918306-47918328 CCCCTTCCTCCACTGGGTTTTGG + Intronic
1157519054 18:48332629-48332651 CCCTTTCCTAGTCTGTTTTTTGG + Intronic
1157745757 18:50133843-50133865 CACCTCCCTCCTTTTTTTTGTGG - Intronic
1157828590 18:50835415-50835437 CCCCCAACTCCCCTTTTTTTTGG + Intergenic
1157886711 18:51374751-51374773 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1158329486 18:56345602-56345624 CCCCTTGCTCCTTTATTTTCTGG + Intergenic
1159087890 18:63814856-63814878 GCCCCTCCTCCTCAATTTTTGGG + Intergenic
1159310959 18:66708219-66708241 CACCTTGCTCCTCTTTATCTGGG - Intergenic
1159388359 18:67756803-67756825 CGCGTTCCTCCTCTTACTTTCGG + Intergenic
1159547314 18:69855627-69855649 TCCTTTTCCCCTCTTTTTTTTGG - Exonic
1159693954 18:71529696-71529718 CCTCCTCCTCCTCAATTTTTTGG - Intergenic
1159909850 18:74135338-74135360 TCTCTTCCTTCTCTTTCTTTAGG + Intronic
1160068840 18:75606560-75606582 CCTCTTCCACCTTTTTTTTTTGG - Intergenic
1160260365 18:77288194-77288216 CCCCTTCATCATTTTTTATTGGG + Intergenic
1160419156 18:78732347-78732369 CCCCTCCCTCCACCTCTTTTTGG + Intergenic
1160919361 19:1512696-1512718 CCCCCTCCCCCTGTTTTTTTTGG - Intronic
1161277216 19:3425221-3425243 CCCTGTCCTCGTCTTTTATTTGG + Intronic
1161917428 19:7239316-7239338 CCTCTTCCTCCTCTTTCCCTGGG - Intronic
1162435429 19:10654964-10654986 CCCCCTCCTCCTCTTTGTCCCGG + Intronic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1162572971 19:11483203-11483225 CCACTTCCTCCTGTTTTATGGGG - Intronic
1163565603 19:18049435-18049457 CCTCTTCCTTTTTTTTTTTTTGG - Intergenic
1164134909 19:22405891-22405913 CCCATCCCTCCTCATTTTGTGGG + Intronic
1164849315 19:31468382-31468404 TCCCTTCCTGCTCCCTTTTTGGG - Intergenic
1165304079 19:34992731-34992753 TCCCTTCCTTTGCTTTTTTTCGG - Intergenic
1165697399 19:37911304-37911326 TCCCTACCCCCTCCTTTTTTGGG - Intronic
1165804379 19:38571643-38571665 CACACTCATCCTCTTTTTTTTGG - Intronic
1166007517 19:39917598-39917620 TCACTTCCTCCTCTTTCTCTTGG + Intronic
1166368851 19:42290670-42290692 CCTCTTGCTCCTCCTTGTTTGGG - Exonic
1167048995 19:47067483-47067505 CCCCTTCCTCCTCCTCCGTTGGG + Exonic
1167196400 19:48031947-48031969 GCCCTTCCTCCTCTCTATCTAGG + Intronic
1167293463 19:48636572-48636594 CCCCAGCCTCCTCTTCCTTTTGG - Intronic
1167909177 19:52688167-52688189 CCCCTGCCCCTTCTTTTCTTTGG + Intronic
1168443486 19:56391927-56391949 CCCCCTCCTTCTCATTTTCTTGG - Intronic
1168726491 19:58585485-58585507 CCAATGCCTTCTCTTTTTTTTGG - Intergenic
925683704 2:6449468-6449490 CCCCTTTGTCCCCTTTTGTTAGG - Intergenic
925727906 2:6892325-6892347 CCCCTTTCTCTTCTTTTTGATGG - Intronic
925851193 2:8083804-8083826 CCCCTTTCACCTCTTCTATTGGG - Intergenic
926437050 2:12849036-12849058 CCTTTTCTTCTTCTTTTTTTTGG + Intergenic
926881798 2:17553042-17553064 CCCCCTCCCCCTCTTTTTATAGG - Intronic
926939596 2:18120609-18120631 CCCCTTCCTCCTTTAGTTGTTGG + Intronic
927031625 2:19125842-19125864 CCCCTCCCTCCTCCTAGTTTTGG - Intergenic
927098579 2:19767885-19767907 TTCCTTCCTCTTCTATTTTTTGG - Intergenic
927309471 2:21613560-21613582 TTCCCTCCTCCTCTGTTTTTTGG + Intergenic
927733062 2:25492849-25492871 TCATTTCCTCCTTTTTTTTTTGG - Intronic
927756912 2:25715992-25716014 AACATTTCTCCTCTTTTTTTGGG - Intergenic
927934888 2:27070854-27070876 CCCCTTCCTTCTCTATAGTTTGG + Intronic
928119210 2:28570136-28570158 TTCCTTCCTCTTCTGTTTTTGGG - Intronic
928461836 2:31481852-31481874 GGCCCTCCTCCTCTATTTTTTGG + Intergenic
928589068 2:32795043-32795065 TTCCTTCCTCCTCAATTTTTTGG - Intronic
928734249 2:34267287-34267309 GCCCCTCCTCCTCAATTTTTTGG + Intergenic
929201034 2:39236349-39236371 CCACTTACTCCTCTCTTTCTGGG - Intergenic
929540971 2:42820910-42820932 TTCCCTCCTCCTCTGTTTTTTGG + Intergenic
929752315 2:44728452-44728474 GCCCCTCCTCCTCAATTTTTTGG + Intronic
931545907 2:63387095-63387117 GTCCTTCCTTCTCATTTTTTTGG - Intronic
931681667 2:64754293-64754315 CATCTTCATCCTCTTTTTTAGGG - Intergenic
932387667 2:71352174-71352196 CCCCCTCCTCCTCTTTATACAGG - Intronic
932977500 2:76621726-76621748 GCCCTTCCTCCTCAATGTTTTGG + Intergenic
933054423 2:77643703-77643725 TCCCTTTCTCTTCTATTTTTGGG + Intergenic
933449002 2:82421994-82422016 CTCCTTCCTTCTCTATTTTAAGG - Intergenic
933855228 2:86406873-86406895 TTCCTTCCTCCTGCTTTTTTGGG - Intergenic
933936817 2:87212662-87212684 ACTCTTTCTCCTCTTTTTCTTGG + Intergenic
934185965 2:89675834-89675856 ATCCTTCGTCCTCATTTTTTTGG + Intergenic
934316685 2:91927428-91927450 ATCCTTCCTCCTCCTTTTTTCGG - Intergenic
934675926 2:96249661-96249683 CCTCTTCCTCTGCATTTTTTGGG - Exonic
935029825 2:99311287-99311309 CCCCTGCCTCCTTTTTTTTGAGG + Intronic
935761359 2:106323611-106323633 TCTCCTCCTCCTCTTTTTTGAGG - Intergenic
935870173 2:107439438-107439460 CCCCCGCCCCCACTTTTTTTTGG + Intergenic
936356326 2:111753163-111753185 ACTCTTTCTCCTCTTTTTCTTGG - Intergenic
936528357 2:113257690-113257712 CCCCCACTTCCTCTTCTTTTAGG - Intronic
936573287 2:113634044-113634066 CCTCTCCCTCCTCTTCTCTTTGG - Intronic
936790897 2:116150285-116150307 CCCTTTCCTCCTCCTGCTTTTGG - Intergenic
936838278 2:116735618-116735640 CTCCTTCCTCCTCAATTTTTTGG - Intergenic
937194346 2:120137811-120137833 TTCTTTCCTCCTCTATTTTTTGG - Intronic
938788663 2:134657123-134657145 GTCCTTCCTCCTCAATTTTTCGG + Intronic
938977868 2:136496444-136496466 CCTTTTCCTCTTTTTTTTTTTGG + Intergenic
939273911 2:139974976-139974998 TTCCTTCCTCCTCTATCTTTTGG - Intergenic
939541141 2:143495221-143495243 CCTTTTCCTCTTCTTTATTTAGG + Intronic
939683479 2:145168532-145168554 GCCTTTCTTCCTTTTTTTTTAGG + Intergenic
940051410 2:149469055-149469077 TCTCTTGCTCCTCTTTTTTCTGG - Intronic
940307850 2:152245695-152245717 CCCCTTCTTTCTTTCTTTTTTGG - Intergenic
940425719 2:153529520-153529542 ATCCCTCCTCCTCTATTTTTTGG - Intergenic
940626307 2:156179746-156179768 CACCTTCCTTCTCTTTTACTTGG - Intergenic
940946467 2:159623616-159623638 TTTCTTCCTCCTCTTCTTTTTGG + Intergenic
941048942 2:160709346-160709368 GTCCCTCCTCCTCGTTTTTTTGG + Intergenic
941066872 2:160913384-160913406 ACCCTTCCTCCTCTTCTCATGGG - Intergenic
941392394 2:164930359-164930381 GCCCCTCCTCCTCAATTTTTTGG - Intronic
941444520 2:165583976-165583998 CGCGTTCCTCCTCTTACTTTCGG - Intronic
941447399 2:165618970-165618992 ACCCTTCCTTTTCTTTCTTTAGG + Intronic
941727690 2:168881403-168881425 CCACTTCTTCCTCTGTTTGTTGG + Intronic
942001195 2:171648752-171648774 TCTCCTCCTCCTCTATTTTTTGG + Intergenic
942144229 2:173010636-173010658 CCCCTTCCTACCTTTTTTGTAGG + Intronic
942168630 2:173267322-173267344 TTCTTTCCCCCTCTTTTTTTTGG + Exonic
942197285 2:173533782-173533804 TTCCTTCCTCTTCTATTTTTTGG + Intergenic
942242996 2:173981028-173981050 CCGGTTCTTTCTCTTTTTTTTGG - Intergenic
942550684 2:177114194-177114216 TTCCTTCCTTCTCTTTTCTTTGG - Intergenic
942609978 2:177733399-177733421 ACCATTCCTCTTCTTTGTTTGGG + Intronic
942624903 2:177889907-177889929 TCCCTTCCTACTTCTTTTTTTGG + Intronic
942719715 2:178937606-178937628 GTCCTTCCTCCTCAATTTTTGGG + Intronic
942863156 2:180640262-180640284 TTTCTTCCTCCTCTATTTTTTGG - Intergenic
942867787 2:180697364-180697386 CCTCTTTCTTCTCTTATTTTTGG - Intergenic
943021495 2:182579723-182579745 CTCATTTCTCCTTTTTTTTTTGG - Intergenic
943087876 2:183335147-183335169 TCACTTCCTCCTCTCTTTGTAGG + Intergenic
944314403 2:198269648-198269670 CCCTTTCCTCCGCTTCTTTCTGG + Intronic
944601855 2:201311253-201311275 GTCCCTCCTCCTCATTTTTTTGG - Intronic
944788836 2:203102840-203102862 GTCCTTCCTCCTCAATTTTTTGG + Intronic
945092173 2:206185878-206185900 CCCTTTCCTCCTCTTCTCATGGG + Intronic
945654442 2:212605875-212605897 CTCCTTCTTCTTTTTTTTTTTGG - Intergenic
945655914 2:212623819-212623841 TTCCTTCCTCTTCTGTTTTTTGG - Intergenic
945902046 2:215549644-215549666 CGCATTCCTCCTCTTGCTTTCGG - Intergenic
946103427 2:217348040-217348062 GACCTTCCTCCTCAATTTTTTGG + Intronic
946424766 2:219587986-219588008 CACATTCCTCCTCTTACTTTTGG - Intergenic
946588892 2:221220922-221220944 TGCCTTCATCCTCTTTTTGTGGG + Intergenic
947184818 2:227445428-227445450 CACGTTCCTCCTCTTACTTTTGG - Intergenic
947496059 2:230638017-230638039 TCCCTCCCTCTCCTTTTTTTGGG - Intergenic
947547807 2:231023513-231023535 GCCCTTCTTGCTCTTATTTTGGG + Intronic
947800115 2:232923934-232923956 CCCTTTCCACCTCTTTTATAAGG - Intronic
948644220 2:239393616-239393638 CCCCTTCCTCCTCCTCATCTGGG + Intronic
1168790331 20:571983-572005 CCTCTTCTTCTTTTTTTTTTTGG + Intergenic
1169894716 20:10490560-10490582 CTACTTCCTGCTCTTTTTTTGGG + Intronic
1170063055 20:12280209-12280231 TTCCTTCCTCCTCTATTTTTTGG - Intergenic
1170135307 20:13067294-13067316 TCCCTTCATCCTCTTTCTATTGG - Intronic
1170149421 20:13213946-13213968 CCCAGTCCTCCTTTTTCTTTTGG - Intergenic
1170350516 20:15435964-15435986 TCTCTTTCTCCTCTGTTTTTTGG + Intronic
1170723822 20:18908042-18908064 CGCATTCCTCCTCTTATTTTTGG + Intergenic
1170883832 20:20320874-20320896 CCCCTCCCTCCTCTCCTCTTTGG - Intronic
1171034589 20:21705367-21705389 CCCCTTCCTCCTCTAGCTTTGGG - Intergenic
1171471284 20:25373848-25373870 CTCCTTTCTCCTCTTCTTTGAGG + Intronic
1172533378 20:35651307-35651329 CCCTTTCATACTCTTTTCTTTGG - Exonic
1172778029 20:37418930-37418952 TCCCTTCCTCCTCCTCTCTTAGG + Intergenic
1172858723 20:38030192-38030214 TCCCTTCTTCCTTTTTTTTCTGG - Intronic
1172977367 20:38916964-38916986 CCCCTGCCTACTATTTTTATTGG + Intronic
1173052295 20:39575181-39575203 ATCCTTCCTCCCCTTTTTTTTGG - Intergenic
1173203843 20:40975691-40975713 TTCCTCCCTCCTCTATTTTTTGG + Intergenic
1173255190 20:41389558-41389580 CTCGTTCCTCTTCTTTTTTCTGG + Intergenic
1173304998 20:41839703-41839725 GCCCCTCCTCCTTGTTTTTTTGG + Intergenic
1173535266 20:43805882-43805904 CCCCTTCCTATTCTTTATTTTGG + Intergenic
1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG + Intronic
1174078023 20:47951666-47951688 CCCCAACCACCTCTTTTATTGGG - Intergenic
1174253845 20:49239312-49239334 CTCCTTCTTCCTCTCTTCTTTGG - Exonic
1175036599 20:56005641-56005663 CCCTCTCCCACTCTTTTTTTTGG - Intergenic
1175273314 20:57749927-57749949 CGCGTTCCTCCTCTTACTTTCGG + Intergenic
1175291503 20:57878997-57879019 CCTCTTCCTCCTCTTCCTTGTGG - Intergenic
1175906859 20:62384754-62384776 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
1176362061 21:6006179-6006201 CCCCCTCCTCCTCCTCCTTTTGG - Intergenic
1176804618 21:13467954-13467976 GTCTTTCCTCCTCCTTTTTTTGG - Intergenic
1176991575 21:15503561-15503583 CCCCTTCCTTCTCTTGATTATGG - Intergenic
1177679096 21:24341052-24341074 CCCCTCCCTTTTTTTTTTTTTGG + Intergenic
1178273474 21:31215288-31215310 CCCATTTCTCTTCTTCTTTTGGG - Intronic
1178515020 21:33239264-33239286 TCCCTTCCTTCTCTTATTTGGGG - Intronic
1178636223 21:34306718-34306740 TCCCTCCCTTCTCTTTTTATGGG - Intergenic
1178642737 21:34358949-34358971 CCACTTTCTCCTCTCTTTCTGGG + Intergenic
1178761172 21:35404273-35404295 CCCCTTCCTCATAATTTTTCTGG + Intronic
1178868616 21:36352384-36352406 CCCCCCCCACCCCTTTTTTTTGG - Intronic
1179477730 21:41658715-41658737 CCTCTTCCACCTCTTTTTTAAGG + Intergenic
1179580960 21:42343685-42343707 CCCCTTCCTCCTCCTTTGGGGGG - Intergenic
1179761457 21:43532366-43532388 CCCCCTCCTCCTCCTCCTTTTGG + Intronic
1179977352 21:44875925-44875947 CCTCCTCCTCCTCCTGTTTTGGG + Intergenic
1180763603 22:18228271-18228293 CCCTTTCCCTCTCTTCTTTTGGG + Intergenic
1180772041 22:18396272-18396294 CCCTTTCCCTCTCTTCTTTTGGG - Intergenic
1180782923 22:18530875-18530897 CCCTTTCCTTCTGTTTATTTGGG + Intergenic
1180803420 22:18645885-18645907 CCCTTTCCCTCTCTTCTTTTGGG - Intergenic
1180807345 22:18723558-18723580 CCCTTTCCCTCTCTTCTTTTGGG + Intergenic
1181218298 22:21349377-21349399 CCCTTTCCCTCTCTTCTTTTGGG + Intergenic
1181239821 22:21470237-21470259 CCCTTTCCTTCTGTTTATTTGGG + Intergenic
1181257651 22:21574179-21574201 CCCCTTCCTCCCTTTCTTATAGG - Intronic
1181505093 22:23349536-23349558 CTCCTTCCTCTTCATTTTTCGGG + Intergenic
1181710363 22:24681606-24681628 CTCCTTCCTCTTCATTTTTTGGG + Intergenic
1181717773 22:24746061-24746083 TTCCCTCCTCCTCTATTTTTCGG - Intronic
1182773991 22:32817592-32817614 TCCCTTCCTCCTTTTTCTTCTGG - Intronic
1183642538 22:39101203-39101225 CCCCTCCCTTCTCTCTGTTTGGG + Intronic
1183978516 22:41526704-41526726 CCCCTTCCTTGTCTTTGTCTAGG - Exonic
1184170432 22:42756185-42756207 TCCCTTCTTCTTCTTTTCTTGGG + Intergenic
1184200487 22:42965410-42965432 CGCCTTCTTCCTCTTTATTGAGG - Intronic
1184303487 22:43578126-43578148 CCCCTTCCTCCTCAGGTTCTGGG + Intronic
1185040152 22:48499769-48499791 CGTCTTCCTCCCCTCTTTTTAGG + Intronic
1185213236 22:49583818-49583840 CCCATTTCTTCTCTTTCTTTTGG - Intronic
1185426897 22:50776836-50776858 CCTCTCCCTCCTCTTCTCTTTGG + Intronic
1203233880 22_KI270731v1_random:137262-137284 CCCTTTCCCTCTCTTCTTTTGGG - Intergenic
950113479 3:10435304-10435326 CCCCTGCTTCCTCCTTATTTGGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950427929 3:12934701-12934723 CCCCTTCCTCTTGCTATTTTTGG + Intronic
950956882 3:17063305-17063327 CTCCTTCCTTCTTTTTTTTTAGG + Intronic
950987173 3:17386251-17386273 CCCCTTCCTCATCTATTCTTTGG + Intronic
951091329 3:18577039-18577061 TCCCTTCCACCTCTTTTATGAGG - Intergenic
951296954 3:20949161-20949183 CTCCCTCCTCCTCAATTTTTTGG + Intergenic
951423446 3:22514875-22514897 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
952200964 3:31126919-31126941 CCCCTTTCTGTTCATTTTTTTGG + Intergenic
952210603 3:31225831-31225853 CCACTTCCCCCTCTTTTCCTTGG + Intergenic
952235772 3:31478373-31478395 GACCTTTCTCCTCTTTTCTTTGG + Intergenic
952334173 3:32391037-32391059 CCCCTCCCTCATCTCTTTTCTGG - Intergenic
952572064 3:34729716-34729738 GTCCTTCCTCCTCAATTTTTTGG - Intergenic
952805537 3:37346944-37346966 TTCCTTCCTCCTCTTTCTTCTGG - Intronic
952814975 3:37439366-37439388 CCACTTCCAGCTCATTTTTTTGG - Intergenic
952878515 3:37968357-37968379 ACCCTTCCCCCTTTTTCTTTTGG - Intronic
952933028 3:38374658-38374680 CCCCTCCCTCCACTGTCTTTTGG - Intronic
953079746 3:39605182-39605204 GCCCTTCATCCTCAATTTTTTGG + Intergenic
953214122 3:40901935-40901957 CCCCTTCCTCCTTCATGTTTAGG + Intergenic
953323202 3:41990631-41990653 GACCTTCTTCCTTTTTTTTTTGG - Intergenic
953484060 3:43277934-43277956 CTCCTTCTTCTTCTTTTTTGAGG - Intergenic
953571629 3:44076135-44076157 CCCCTTCATCCTCTTCCTGTTGG - Intergenic
953864034 3:46568152-46568174 TCCCTTCCTCCTCTATTTTCTGG - Intronic
954596337 3:51828694-51828716 GCCTTTCCTCCTCAATTTTTTGG + Exonic
955813806 3:62820773-62820795 CTCTTTCTTCCTCTTTTTTTTGG + Intronic
955940992 3:64146968-64146990 CCTCTTCCTCCTCATATTTGGGG + Exonic
956086554 3:65617300-65617322 CCCATTCCTCCTCACTTTTCTGG - Intronic
956260863 3:67339540-67339562 TCCCTTCATCCTGATTTTTTTGG - Intergenic
956689995 3:71867522-71867544 CCCTTTCCTGCCCTTTTTATTGG - Intergenic
956726731 3:72162718-72162740 GCTCTTCCTCCTCTCTCTTTGGG + Intergenic
956852399 3:73241653-73241675 TTCCTTCCTCCTCTATTTTTTGG + Intergenic
957037417 3:75307538-75307560 CCCCTTCGAATTCTTTTTTTTGG + Intergenic
957079416 3:75623672-75623694 CACCTTCATCCTCTTTTTCTGGG - Intergenic
957404943 3:79765369-79765391 CTGCTTCCTCTTCCTTTTTTTGG + Intronic
957485867 3:80861962-80861984 TTCCCTCCTCCTCTTTTTATTGG - Intergenic
957615716 3:82524120-82524142 ACAATTCCTGCTCTTTTTTTTGG + Intergenic
957916127 3:86690349-86690371 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
958030601 3:88104747-88104769 CCTCTTCTTCCTCCTTCTTTGGG - Intronic
958115528 3:89211826-89211848 CCTCCTCCTCCTCTTTCTTTTGG + Intronic
958772945 3:98448230-98448252 CCCCCGCCTCCCCTTTTTTTTGG + Intergenic
959868233 3:111296200-111296222 ATCCCTCCTCCTCTATTTTTTGG + Intronic
959982453 3:112530401-112530423 CCCCCCCCGCCTTTTTTTTTTGG - Intergenic
960685969 3:120293952-120293974 GCCCCTCCTCCTCACTTTTTTGG - Intergenic
960729047 3:120704014-120704036 TTCCTTCCTCTTCTATTTTTTGG - Intronic
960861723 3:122161597-122161619 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
960870277 3:122241633-122241655 TTCCTTCCTCCTCTGTTTTTTGG - Intronic
961229168 3:125286237-125286259 CTCCCTCCACTTCTTTTTTTGGG - Intronic
961396449 3:126595379-126595401 ACCCTTTCTCCTCTTCTTCTGGG - Intronic
961591441 3:127984610-127984632 CCACTTCCTCCTCATCCTTTTGG - Exonic
962205196 3:133428481-133428503 ACCCATCCTCTTTTTTTTTTTGG - Intronic
962319407 3:134378128-134378150 CCACTTCCTCCCCTTTTTCTAGG + Intergenic
962322448 3:134403032-134403054 CCTCTTCCTCCACTCTTGTTAGG - Intergenic
962712526 3:138100023-138100045 CCCCATCCTTTTTTTTTTTTTGG + Intronic
962870368 3:139484637-139484659 TTCCTTCCTCCTTTATTTTTTGG + Intergenic
963249540 3:143090334-143090356 CCCTTTCCTTCTCTATATTTGGG + Intergenic
963593669 3:147298026-147298048 CCCCTTACTCTTTTTTTTTCAGG + Intergenic
963614975 3:147525211-147525233 GGCCCTCCTCCTCTATTTTTTGG + Intergenic
963996395 3:151715000-151715022 TTCCTTCCTCTTCTATTTTTTGG - Intergenic
964086546 3:152826149-152826171 CCACTTACTCCTTTTTTTTTTGG + Intergenic
964301914 3:155297577-155297599 GCCCTTTCTCTTCTTCTTTTAGG - Intergenic
964450504 3:156808182-156808204 CCCTTCCCTTCTCTTTTTTTTGG - Intergenic
964528820 3:157645048-157645070 ACCCATCATCCTCTTTCTTTGGG - Intronic
964804395 3:160591561-160591583 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
964843492 3:161020577-161020599 CTCCTTCCTCTTGTATTTTTTGG + Intronic
964923670 3:161929274-161929296 CTCCTTCATTCTCTCTTTTTGGG - Intergenic
965636098 3:170782463-170782485 GTCCTTCCTCCTCAATTTTTGGG - Intronic
965711167 3:171557889-171557911 CTTCTTCTTCTTCTTTTTTTTGG - Intergenic
965748194 3:171947494-171947516 GTCCTTCCTCCTCAATTTTTTGG + Intergenic
966115005 3:176451018-176451040 CCCCTTTATCATTTTTTTTTTGG + Intergenic
966142495 3:176771759-176771781 TTCCATCCTCCTCTATTTTTTGG - Intergenic
966234209 3:177682710-177682732 CCCCTCCCTGTACTTTTTTTTGG + Intergenic
966359356 3:179118475-179118497 TTCCATCCTCCTCTATTTTTTGG - Intergenic
966679002 3:182620307-182620329 CTTTTTCTTCCTCTTTTTTTGGG - Intergenic
967004615 3:185372309-185372331 CCCCTTCCTCCTCCTTTTTCTGG + Intronic
967034236 3:185636216-185636238 ACCTTTCCCCCTTTTTTTTTTGG + Intergenic
967057100 3:185839048-185839070 TCCCTTCTTCTTCTTTTTTTTGG - Intergenic
967502758 3:190219126-190219148 CTCCCTCCTCCTCAGTTTTTCGG + Intergenic
967587873 3:191236482-191236504 CGCATTCCTCCTCTTGCTTTTGG - Intronic
968109305 3:196030259-196030281 TCCCCTCCTCCTCTATTTTTTGG - Intronic
969022499 4:4147617-4147639 CACCTTCATCCTCTTTTTCTGGG - Intergenic
969158939 4:5238364-5238386 CTCCTTTCTTCTTTTTTTTTTGG + Intronic
969438794 4:7204943-7204965 TCTCTTCCTCCTCTGCTTTTAGG + Intronic
969731386 4:8959783-8959805 CACCTTCATCCTCTTTTTCTGGG + Intergenic
969790989 4:9493891-9493913 CACCTTCATCCTCTTTTTCTGGG + Intergenic
969939684 4:10718209-10718231 CCTCTTTCTCCTCTCTTTCTTGG - Intergenic
970210105 4:13700898-13700920 GTCCTTCCTCCTCAGTTTTTTGG + Intergenic
971178746 4:24307553-24307575 TCCTTGCCTCCTCTTATTTTGGG - Intergenic
971478350 4:27092588-27092610 CCCCTTACTCAGCTTTTCTTGGG + Intergenic
972620424 4:40743301-40743323 CCCCTCCCCTCTTTTTTTTTTGG + Intergenic
972709514 4:41580643-41580665 TTCCTTCTTCCTGTTTTTTTAGG - Intronic
972715079 4:41637646-41637668 CCCTTTCCTTGTCTTGTTTTTGG + Intronic
972781953 4:42293957-42293979 ACGCTTCCTCCACTTTGTTTTGG + Intergenic
973143925 4:46801712-46801734 CCCCTTCCAACTTTTATTTTAGG - Intronic
973214702 4:47655945-47655967 TTCCTTCCTCCTCTATTGTTTGG - Intronic
973321680 4:48816971-48816993 CCTCTCCCACCCCTTTTTTTGGG - Intronic
974290973 4:59930107-59930129 TCCCTTGCTCCTCTAGTTTTTGG - Intergenic
974512555 4:62863656-62863678 CCCCCTCCACCTCAATTTTTGGG + Intergenic
974733784 4:65901700-65901722 CTCCTTCCTGATCTTTTTTTTGG + Intergenic
975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG + Intergenic
975613188 4:76221306-76221328 CCCATTACTCCTCTTTTGTTTGG + Intronic
975957344 4:79857203-79857225 CCCCTTCCTCCTGGTTCTCTAGG + Intergenic
976338817 4:83921829-83921851 CCCACTGCTCCTCTTTTTTTAGG - Intergenic
976799466 4:88972598-88972620 GCCCCTCCTTCACTTTTTTTTGG + Intronic
977005655 4:91566421-91566443 GCCCCTCCTCCTCAATTTTTTGG + Intronic
977387262 4:96357519-96357541 CGCGTTCCTCCTCTTACTTTTGG + Intergenic
977873276 4:102119345-102119367 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
977915656 4:102589814-102589836 TACCTTTCTTCTCTTTTTTTGGG - Intronic
977948301 4:102939512-102939534 ATCCTTCCTCCTCATTTTTTTGG - Intronic
978170027 4:105658821-105658843 CCTCTTCCTGCTCACTTTTTAGG + Intronic
978307790 4:107351077-107351099 CACATTCCTCCTCTTACTTTTGG - Intergenic
978673308 4:111277861-111277883 CGTTTTCCTACTCTTTTTTTGGG - Intergenic
978733865 4:112063110-112063132 TTCCTTCCTCCTCTATTTTTTGG - Intergenic
979280609 4:118863192-118863214 CTCCCTTCTCCTCTATTTTTCGG + Intronic
979413757 4:120410806-120410828 CTCCCTTCTCCTCTATTTTTTGG - Intergenic
979466720 4:121048039-121048061 CCCTCTGCTCCTCTTTTGTTTGG + Intronic
979664597 4:123296822-123296844 CCCCTTTCTCCTATTTTCTAAGG + Intronic
979878008 4:125917676-125917698 CCCCTTCCTTCTCTGTTTGCAGG - Intergenic
979912912 4:126392738-126392760 TTCCCTCCTCCTCTGTTTTTTGG + Intergenic
980413292 4:132451168-132451190 TTCCCTCCTCCTCTATTTTTCGG - Intergenic
980612291 4:135174567-135174589 CACGTTCCTCCTCTTTCTTTTGG - Intergenic
980850585 4:138376077-138376099 CATCCTCCTCCTCTATTTTTTGG - Intergenic
980956222 4:139431834-139431856 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
981184497 4:141784921-141784943 CCCATTCCTGATCTTTTTCTGGG + Intergenic
981195521 4:141915816-141915838 CGCATTCCTCCTCTTACTTTCGG + Intergenic
981582944 4:146268858-146268880 CCCCTTGCACCCCTTTTTTAGGG - Intronic
982051054 4:151502659-151502681 CCCCTTTCTCTTCTCCTTTTAGG - Intronic
982290438 4:153776323-153776345 TCCCTTCCTCTTCTATTTTCTGG + Intergenic
982450244 4:155544165-155544187 CCCCTTCAGCCTCTTTTGTAAGG + Intergenic
982570665 4:157047046-157047068 CCCCTTTCTTCTTTTTTCTTTGG - Intergenic
982578693 4:157150709-157150731 CCCCTTCCCCATCTTTTTTACGG + Intronic
983242355 4:165247738-165247760 CCTCTTCCTCATCTTCCTTTTGG - Intronic
983568807 4:169182855-169182877 CACCTTTCTCCTTTTTTTTTTGG - Intronic
984478408 4:180266296-180266318 ACCCTTCCTCCTCTCCTTTAGGG - Intergenic
984641725 4:182173494-182173516 CCCATTCCTCATCTTTTTATTGG - Intronic
985421326 4:189787948-189787970 CTCCTGCCTCCCCCTTTTTTTGG - Intergenic
985482344 5:122195-122217 TCCTTTCATCCTCTATTTTTTGG - Intergenic
985698490 5:1356699-1356721 CGCCTTTCTCCTCTTAGTTTCGG - Intergenic
985799085 5:1991745-1991767 CCCCTTGCCCGTCTTTTTATTGG - Intergenic
985844072 5:2331097-2331119 CCCATTCCTCCTCTCTTTGGAGG + Intergenic
986146129 5:5079450-5079472 TGCCTTCCTCCTCTTGTTTTCGG - Intergenic
986159318 5:5211117-5211139 TCCCTTCCTCTTCTGTTTTCTGG + Intronic
986167502 5:5288059-5288081 CTCCTTCCTCCTCTAGTTTCGGG - Intronic
986217632 5:5735034-5735056 GCCCTTCCTTCTCAATTTTTTGG + Intergenic
986266421 5:6195182-6195204 CTCATTCCTCCTCTTGCTTTTGG - Intergenic
986762094 5:10889567-10889589 CCCCTTTCTCTTCTTGTTTCCGG - Intergenic
987783320 5:22466608-22466630 CCGCAGCCTCCTCTTTTTTCTGG - Intronic
987834427 5:23143297-23143319 CCCCTTTATCATCTTTTATTGGG + Intergenic
987896647 5:23954679-23954701 GTCCTTCCTCCTCATTTATTTGG + Intronic
988021174 5:25624514-25624536 CTCATTCCTCCTCAATTTTTTGG - Intergenic
988376493 5:30441974-30441996 TTCCCTCCTCCTCTGTTTTTTGG - Intergenic
988870896 5:35388373-35388395 GTCCTTCCTCCTCAATTTTTTGG - Intergenic
989156011 5:38345581-38345603 GCCCTTCCTCCACCATTTTTTGG - Intronic
989488909 5:42027080-42027102 CTCCCTCCTCCTATGTTTTTTGG + Intergenic
989555175 5:42786145-42786167 CTCCCTCCTCCTCAATTTTTTGG + Intronic
989688283 5:44113564-44113586 CCCATTCTTCCTCTTGTTATTGG + Intergenic
989750933 5:44892749-44892771 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
989765677 5:45080643-45080665 CTCCTTCCTCTTCTTTTTATTGG + Intergenic
990577971 5:57141878-57141900 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
990861903 5:60336649-60336671 TCACTCCCTCCTCTCTTTTTAGG + Intronic
991394873 5:66194179-66194201 TTCCTTCCTCCTTTATTTTTTGG + Intergenic
991663991 5:68978703-68978725 ATCCCTCCTCCTCTATTTTTTGG - Intergenic
992011706 5:72534096-72534118 CCCCTTCCTCCTCTTTAGAAAGG - Intergenic
992103121 5:73426442-73426464 ACCTTTCCTCTGCTTTTTTTTGG - Intergenic
992458331 5:76937278-76937300 CCCCTTCCTCCTCATTACATAGG - Intergenic
992824425 5:80534215-80534237 TTCCCTCCTCCTCTATTTTTTGG - Intronic
993163812 5:84325012-84325034 CTCCTTCCTCTTCGATTTTTTGG - Intronic
993204368 5:84861380-84861402 CCCCTTGTGCCTCTTTTTTGAGG - Intergenic
993390360 5:87313382-87313404 CCTCTCCTTCCTCTTTTTCTTGG - Intronic
993419449 5:87682731-87682753 GCCCTTCCTCCTGTCTTTTGGGG - Intergenic
993465444 5:88240440-88240462 CCCCTACCTTCTTTCTTTTTCGG - Intronic
993881937 5:93373437-93373459 CCCCTTTCTCATTTTTGTTTTGG - Intergenic
993944295 5:94099086-94099108 GTCCTTCCTCCTCAATTTTTTGG - Intronic
993992729 5:94679753-94679775 CTCCTTCCTCCCTTTATTTTAGG - Intronic
994226548 5:97258198-97258220 TCCCTCCCTCCTCTATTTTCTGG - Intergenic
994603617 5:101939675-101939697 GCCCCTCCTCCTCAATTTTTTGG + Intergenic
994640981 5:102409829-102409851 CCCCTGCGTCCTTTTTTTCTAGG - Intronic
994660302 5:102645701-102645723 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
994808492 5:104481443-104481465 ACCCTTCTTCCACTTTTTGTGGG + Intergenic
994940790 5:106321421-106321443 CCCCTTCCTCCTCATCTGCTGGG - Intergenic
995255667 5:110043637-110043659 GCCCTTCTTTGTCTTTTTTTTGG + Intergenic
995289487 5:110434567-110434589 GTCCTTCCTCCTCGATTTTTTGG - Intronic
995310927 5:110710353-110710375 TTCCTTCCTCCTATATTTTTTGG - Intronic
995820895 5:116230999-116231021 CCTCTGGCTCCTCTTTTTTAAGG + Intronic
995862526 5:116656786-116656808 CCTCATCCTCATCTTTTTCTAGG - Intergenic
996379601 5:122849590-122849612 CCCCTCCCCCCCCCTTTTTTGGG - Intronic
996456173 5:123684982-123685004 GCCCTTCCTCCTTGATTTTTTGG - Intergenic
996507069 5:124279414-124279436 TCCCTTCCTACCTTTTTTTTTGG + Intergenic
996618191 5:125467322-125467344 TCCCCTCCTCCTATTTGTTTGGG - Intergenic
996631807 5:125641899-125641921 CCCCTTCCTCCCATGTTTTATGG - Intergenic
996756725 5:126943807-126943829 ACCCTTACTCTTTTTTTTTTTGG + Intronic
996852828 5:127971807-127971829 CCCTTTCTTCCTCTATTTTTTGG + Intergenic
996944549 5:129050739-129050761 CACCTTTCCCCTCTGTTTTTTGG - Intergenic
997061974 5:130516974-130516996 CCCCTCCCTCCTTGATTTTTTGG + Intergenic
997188664 5:131908042-131908064 TTCCTTCATCCTCTATTTTTTGG - Intronic
997337170 5:133116567-133116589 CCCCTTCATGCTGTTTTCTTGGG + Intergenic
997403707 5:133625154-133625176 TTCCTTCCTCCTCTGTTTTCTGG + Intergenic
997465706 5:134086706-134086728 CCCCTTCTCCTTCTTTTCTTGGG + Intergenic
997527209 5:134561057-134561079 TCCCTTCCTCCTCCTTCTTAAGG - Intronic
997587314 5:135051087-135051109 CCTCTTCCTTCTCTTCCTTTTGG + Intronic
997680301 5:135745583-135745605 CCCCTGCCTCCTGCTTTTTAAGG + Intergenic
997893992 5:137699547-137699569 GCCCTGCCTTCTCTCTTTTTTGG - Intronic
998984705 5:147743693-147743715 TGTCTTCCTCCTCTTGTTTTTGG + Intronic
999590125 5:153135850-153135872 TCCATTCCTCGTCTTGTTTTTGG - Intergenic
999795284 5:154983169-154983191 CCCCTGCTTCCACTTCTTTTGGG + Intergenic
999951219 5:156653127-156653149 GTCCTTCCTCCTCGGTTTTTTGG + Intronic
1000017502 5:157290870-157290892 TCCCCTCCTCCTCTTTTCTCTGG - Intronic
1000071730 5:157746063-157746085 CCCCTTCCAACTTTTGTTTTTGG - Intronic
1000101607 5:158022238-158022260 CCCCTTCCTTCTTTCATTTTGGG + Intergenic
1000308382 5:160017411-160017433 TCCCTTCAACCTCTTTTATTAGG + Intronic
1000311801 5:160052167-160052189 CCCCATCCCCCTCCCTTTTTTGG - Intronic
1000540941 5:162538829-162538851 CACCTTCCTCCTCTTCTCTCAGG - Intergenic
1000583909 5:163071100-163071122 TTCCTTCCTCCTCTATTTTTTGG + Intergenic
1000632860 5:163610917-163610939 CCCCTTCCTCACCTTTATGTTGG + Intergenic
1000947737 5:167442123-167442145 CCCCTTCCTCCCCTTTCAATGGG + Intronic
1001357208 5:171039981-171040003 GCACTTCCTCCTCGATTTTTTGG - Intronic
1001738573 5:174029099-174029121 TTCCTTTCTCCTCTTTTTCTGGG - Intergenic
1002545276 5:179938569-179938591 CTCATTTCTCTTCTTTTTTTAGG + Intronic
1002563227 5:180096433-180096455 TCCCTTCCTTCCTTTTTTTTTGG + Intergenic
1002563229 5:180096434-180096456 CCCTTCCTTCCTTTTTTTTTGGG + Intergenic
1002652763 5:180714011-180714033 TCCCTTCCTCTTCAATTTTTTGG - Intergenic
1002770941 6:290733-290755 CCCTTTCTGCCTCTTGTTTTGGG - Intergenic
1003264817 6:4556207-4556229 ACCCTTCCTCTTTTTTTTCTTGG - Intergenic
1003511895 6:6788675-6788697 CCCCTTCCTCCTCTTCTGGCAGG - Intergenic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1003673061 6:8177817-8177839 CACCTTCCTTCTCATTTTTCTGG + Intergenic
1004772520 6:18800315-18800337 CCCACTTCTCCTCTTTTTGTTGG + Intergenic
1004842795 6:19606195-19606217 TGCCTTCCTCCTCCTTTTTTAGG - Intergenic
1005258380 6:24029856-24029878 CTCCTTCTTCTTCTTCTTTTTGG + Intergenic
1005264529 6:24097841-24097863 TCCCTGCCCTCTCTTTTTTTTGG - Intergenic
1005458213 6:26042446-26042468 TGCCTTCCTCCTCTTACTTTCGG + Intergenic
1005565099 6:27083675-27083697 TCCCTTGTTTCTCTTTTTTTTGG + Intergenic
1005706517 6:28459975-28459997 CTCCTTCCTTCTCTTTATTCAGG - Intergenic
1005817583 6:29568459-29568481 CTTCTTCTTCTTCTTTTTTTCGG + Intronic
1005881977 6:30069062-30069084 ACCCTTCCTCCTCTTTAACTGGG + Intronic
1006185814 6:32181211-32181233 CCTCTTCCTCCTGGTTTTCTGGG + Exonic
1006963396 6:37957177-37957199 CCCTTTCTTCCTCTCTTTTCAGG + Intronic
1007162621 6:39804124-39804146 CCCCAGCCTCCTCTGTTTATGGG + Intronic
1007345932 6:41229437-41229459 CCCCTACCTCCTCTTATGTATGG + Intronic
1007779941 6:44246943-44246965 TCCCCGCCCCCTCTTTTTTTCGG + Intronic
1008592612 6:53009280-53009302 CCCTATCCTCCTCTCTTTCTCGG - Intronic
1008860134 6:56139021-56139043 GCCTTTCCTCCTCTTATTATGGG - Intronic
1009657879 6:66569238-66569260 CCACTGCCTCCCCCTTTTTTTGG - Intergenic
1009874815 6:69492922-69492944 ACCCTACCTGCTCTTTTTTTCGG + Intergenic
1010178199 6:73054303-73054325 GTCCCTCCTCCTCTGTTTTTTGG - Intronic
1010526868 6:76911259-76911281 CCCCCTCCTCTTCAGTTTTTTGG - Intergenic
1011161737 6:84398530-84398552 CCTCCTCCTCCTCTTCTTCTTGG - Intergenic
1011925942 6:92644865-92644887 CCTCCCCCTCCACTTTTTTTCGG + Intergenic
1012003843 6:93687609-93687631 TTCCTTCCTCCTCTATTTATTGG - Intergenic
1012070683 6:94611334-94611356 CTCCTACCTCCTCAATTTTTTGG - Intergenic
1012483656 6:99696090-99696112 TTCCTTCCTCCTCTATTTTTTGG - Intergenic
1012602471 6:101115146-101115168 CCCCCTCATCCTCTGTTGTTGGG + Intergenic
1012690409 6:102304051-102304073 CTCCTTCCTCCTTTATTTTATGG - Intergenic
1012845672 6:104385024-104385046 ATCCTTCCTCCTCAATTTTTTGG - Intergenic
1013480212 6:110546521-110546543 CCCCTTCCTCCTCATCTTCCTGG + Intergenic
1013744060 6:113323572-113323594 CCCCTTCCTTATTATTTTTTTGG + Intergenic
1014062339 6:117086198-117086220 CCTCTTCCTTCTCTTCTTCTGGG - Intergenic
1014364825 6:120526072-120526094 GGCCTTCCTCCTCAATTTTTTGG + Intergenic
1015287024 6:131497492-131497514 CCCCATCTTGCTCTTTTTATGGG + Intergenic
1015578332 6:134696974-134696996 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
1016411823 6:143791249-143791271 CTTCTTCCTCCTAATTTTTTGGG + Intronic
1016486344 6:144543686-144543708 CCTCTTCTACCTCTTTTTTTTGG + Intronic
1016761817 6:147746244-147746266 TCCCTTCCTCCTCTTTTGAGTGG + Intergenic
1017863674 6:158423111-158423133 CCCCCCCCCCCTCTTTTTTGTGG - Intronic
1018279769 6:162172895-162172917 CCCCTTCTTCCTCTTTCTTCTGG - Intronic
1019600158 7:1878273-1878295 TTCCCTCCTCCTCTTTTTTCTGG - Intronic
1019961517 7:4464364-4464386 CCCCTTCCACCTCTATGATTTGG + Intergenic
1020309911 7:6859653-6859675 CACCTTCATCCTCTTTTTCTGGG - Intergenic
1020371150 7:7433192-7433214 CCCCTCCCTGCTCTTTCTGTAGG - Intronic
1020418707 7:7975002-7975024 CCCTTTCCTCCACTTACTTTTGG - Intronic
1020651669 7:10883760-10883782 GTCCTTCCTCCTCGATTTTTTGG + Intergenic
1021260829 7:18454930-18454952 CGCCATCCTCCTCCATTTTTAGG - Intronic
1021276164 7:18654309-18654331 CCTCTTCCTCCCCTTGTTTTAGG + Intronic
1021569673 7:22051968-22051990 CCCCCCCCTCCTCTATTTTATGG - Intergenic
1021570084 7:22056223-22056245 CCATTTCCTCCTCTTTTTTTTGG - Intergenic
1021599881 7:22354961-22354983 CCCCTTCCTACTCCTTTGATGGG + Intronic
1021751727 7:23807639-23807661 ACCCTTTCTCCTCTTTTTCTAGG + Intronic
1022525706 7:31035676-31035698 CCCCTTCAACCTCTTTTATAAGG + Intergenic
1022742884 7:33140022-33140044 CCTCTTCTTTTTCTTTTTTTTGG + Intronic
1023220326 7:37915499-37915521 CCACTTCCTTCTTTTTTCTTTGG - Intronic
1023414953 7:39923157-39923179 CCCCTGCCCCCACTTTGTTTGGG - Intergenic
1023459362 7:40378211-40378233 CTCTCTTCTCCTCTTTTTTTTGG + Intronic
1023588181 7:41752518-41752540 TGCCTTCCTCCTCTTGCTTTAGG - Intergenic
1023694623 7:42831995-42832017 CCACTTGCTCCTTTTTTCTTTGG - Intergenic
1023977602 7:45042339-45042361 CCTCTTTCTCCTCTCTTTTCAGG - Intronic
1024055968 7:45660020-45660042 CCTCTGCCTCCTCCTTTTGTAGG + Exonic
1024261514 7:47577311-47577333 CCTCTTCCTCTTCTCTTTTGGGG - Intronic
1024445764 7:49476650-49476672 GTCCTTCCTCCTCAATTTTTTGG + Intergenic
1024674002 7:51621842-51621864 CGCATTCCTCCTCTTACTTTTGG - Intergenic
1024916542 7:54506533-54506555 CCCCTTACTCCATCTTTTTTTGG + Intergenic
1024976429 7:55117951-55117973 TCCCTTCCTTCTCCTTTTCTGGG - Intronic
1024991785 7:55240440-55240462 CTCCTTCTGCCTCTTCTTTTCGG + Intronic
1025228452 7:57182819-57182841 CCTCCTCCTCCTCTTTTATAGGG + Intergenic
1025965092 7:66262328-66262350 TCCCTTCCTCTTCTTTCATTGGG + Intronic
1025975222 7:66364330-66364352 CATCTTCCTCCTTTTTATTTTGG - Intronic
1026123835 7:67562120-67562142 CGCGTTCCTCCTCTTACTTTTGG + Intergenic
1027306131 7:76899266-76899288 TTCCTGCCTCCTCTTTTTCTGGG + Intergenic
1027627154 7:80560474-80560496 GTCCTTCCTCCTCAATTTTTTGG + Intronic
1028354894 7:89895077-89895099 CCCTTTCCTCATATTTTATTAGG + Intergenic
1028675638 7:93457503-93457525 ACTCTTTCTCTTCTTTTTTTGGG - Intronic
1029221635 7:98995132-98995154 ACCCTTCCTTCACTTGTTTTTGG + Intronic
1029568305 7:101354255-101354277 CTCCTTCCTCCTCCTTTCCTTGG - Intergenic
1030488369 7:110200221-110200243 TTCCTTCCTCCTCTATTTTTTGG + Intergenic
1031164955 7:118216731-118216753 TCCCTTCTTGCTCTATTTTTGGG + Intronic
1031867317 7:127051902-127051924 CCCCTTCTTCCTCTTTCCTAAGG - Intronic
1032122798 7:129169108-129169130 CCCCATCCCCCTCCTGTTTTGGG - Intronic
1032123493 7:129173791-129173813 CTCCTTCCTTCTCTTGTTTCTGG - Intergenic
1032199196 7:129807303-129807325 GCCCTTCCACCTCTTGTTATGGG - Intergenic
1032597190 7:133253351-133253373 CCCCCTCCACCTTTTTTTTCTGG + Intronic
1032726921 7:134598600-134598622 GTCCTTCCTCCTCATTTTTTTGG + Intergenic
1032869957 7:135974539-135974561 CCTCCTCCTCCTCTTTTTTTTGG - Intronic
1032965877 7:137096835-137096857 ATCCTTCCTCCTCATTTTTTTGG - Intergenic
1033285239 7:140035830-140035852 CCTCTTCCTCCTCCTTCTTTTGG - Intronic
1033340916 7:140491597-140491619 CCTCTGCCTCATCTTTCTTTTGG - Intergenic
1033378923 7:140793321-140793343 CCCTTTCTTCCTTTGTTTTTAGG + Intronic
1033532268 7:142276566-142276588 GTCCTTCCTCCTCAATTTTTTGG - Intergenic
1034339207 7:150341297-150341319 TCCCTCCTTCCTCTTTTTTCTGG + Exonic
1034625106 7:152486427-152486449 CTTCTTCTTCTTCTTTTTTTTGG - Intergenic
1034746590 7:153528809-153528831 CCCTCTCTTCCCCTTTTTTTAGG + Intergenic
1034895806 7:154875706-154875728 CCTCTTCCTCCTCACTTTATGGG + Intronic
1035237170 7:157506038-157506060 CCCTTCTCTCCTCTTTTTATGGG + Intergenic
1035285317 7:157802266-157802288 CTCCATCCTCCTCTCTTCTTCGG + Intronic
1036973318 8:13380444-13380466 CCCCTTCCTCCACCTTTTTGTGG + Intronic
1037119827 8:15269444-15269466 TGCCTTCCTCTTCATTTTTTTGG - Intergenic
1037570858 8:20156640-20156662 CTCCTTGCTCTTCTTCTTTTAGG + Intronic
1038892967 8:31747645-31747667 TCCCTGCCTCCACTTTGTTTTGG + Intronic
1039084572 8:33767149-33767171 CCCCTCCCTCCACTTTTTTTTGG + Intergenic
1039448459 8:37651225-37651247 CCCTTTCCTGCTCTGTTTCTGGG + Intergenic
1039625504 8:39047334-39047356 TCTCCTCCTCCTCTATTTTTTGG + Intronic
1039665235 8:39518565-39518587 CTCCTTCCTCTTCCATTTTTTGG + Intergenic
1039875436 8:41580792-41580814 CTCCTCCCTCCTCTATCTTTAGG - Intronic
1040033256 8:42844829-42844851 CGCGTTCCTCCTCTTACTTTCGG + Intergenic
1040361295 8:46666787-46666809 ACCCTTCCTCCCCTATTTCTGGG - Intergenic
1040714200 8:50227348-50227370 CCCCTCCCTCTTCTCTTTCTTGG - Intronic
1041417319 8:57625998-57626020 TCCCTTCCTCCTATGTTGTTAGG + Intergenic
1042032732 8:64494271-64494293 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1042872385 8:73410664-73410686 CTCCTGCCTCCTCCTTCTTTGGG - Intergenic
1043585688 8:81767252-81767274 TTCCTTTCTCCTCTCTTTTTGGG + Intergenic
1043945594 8:86248308-86248330 CCTCCTCCTCCTCTATTTATTGG + Intronic
1044878439 8:96696974-96696996 TTCTTTCCTCCTCTATTTTTTGG - Intronic
1044933722 8:97274730-97274752 TCCCTACCTTCTCTTTTGTTAGG - Exonic
1045110677 8:98937130-98937152 CCCCATCCTCATAGTTTTTTGGG - Intronic
1045660610 8:104433633-104433655 TTCCTTTCTTCTCTTTTTTTTGG - Intronic
1045851448 8:106703735-106703757 CCCATTCCTCCTTTTCTTTCTGG - Intronic
1046040000 8:108891702-108891724 CCCCTTTCTCTTCTTGTTCTTGG - Intergenic
1046040802 8:108901730-108901752 TCTCTTTCTCCTCTTTTTCTGGG - Intergenic
1046083991 8:109408913-109408935 CCCTTTCCTTCTCTTGTCTTTGG - Intronic
1046667038 8:117015547-117015569 CTCCCTCGCCCTCTTTTTTTTGG - Intronic
1047562704 8:126007108-126007130 CTACTTCCTCCTCTTTTTATTGG - Intergenic
1047909718 8:129514927-129514949 TCCAGTCCTCCTCTTTTTTCAGG + Intergenic
1048046473 8:130777847-130777869 CCCCTTGCTCCTCTATTTCCTGG + Intergenic
1048343069 8:133555551-133555573 CCCCTCCTTTCTTTTTTTTTAGG - Intronic
1048589739 8:135810338-135810360 ACCCTCCCTCCTCCTATTTTGGG + Intergenic
1048688743 8:136934455-136934477 CGCGTTCCTCCTCTTACTTTCGG + Intergenic
1048766532 8:137850630-137850652 TCCCTACTTCCTCTTTTTCTAGG - Intergenic
1048982149 8:139708368-139708390 GCCCCTCCTCCTCATCTTTTAGG + Intergenic
1050135205 9:2455859-2455881 TTCCTTCCTCCTCTATTTTTTGG - Intergenic
1050548139 9:6726552-6726574 CGCCTTCCTCCGCTTCTCTTTGG + Intronic
1050924800 9:11250388-11250410 TCTCTTTCTCTTCTTTTTTTTGG - Intergenic
1051067453 9:13121809-13121831 ACACTTCCTCCTCTTTGTATGGG + Exonic
1051500944 9:17777068-17777090 GACCTTCCTCTTCTTTATTTCGG + Intronic
1051516856 9:17939380-17939402 CCCCTTTCTACCATTTTTTTTGG + Intergenic
1051704658 9:19864281-19864303 CCTCTGCCTCCTCTATTTTTTGG - Intergenic
1052104361 9:24494082-24494104 CCACCTCCTCCTTTTTTTGTCGG + Intergenic
1052402380 9:28016799-28016821 GTCCTTCCTCCTCAATTTTTTGG - Intronic
1052618978 9:30880682-30880704 GCTCTTCCTCCTCAATTTTTTGG + Intergenic
1052831016 9:33215723-33215745 TCCTTTCCTCCTATATTTTTTGG - Intergenic
1052839987 9:33284706-33284728 CTCCCTCCTCCTGTATTTTTTGG + Intergenic
1052952936 9:34228570-34228592 CCCCCCCCCCCTTTTTTTTTTGG + Intronic
1053072456 9:35109321-35109343 CCCCTTCCCCTTCTTGTTTTTGG - Exonic
1054993731 9:71360862-71360884 CCTCTTCCTTCTTTTTTTTCTGG - Intronic
1055104169 9:72495174-72495196 CCCCTACTTTCTCTTTTCTTGGG + Intergenic
1055220759 9:73928043-73928065 CCCCTCCTTTCTTTTTTTTTTGG - Intergenic
1055225305 9:73988348-73988370 GTCCTTCCTCCTCATTTTTTGGG - Intergenic
1055811345 9:80151887-80151909 GTCCTTCCTCCTCAATTTTTTGG + Intergenic
1055905254 9:81286181-81286203 TTCCCTCCTCCTCTGTTTTTTGG + Intergenic
1056252155 9:84760734-84760756 CCCTTTCCACCTCTTTACTTTGG - Intronic
1056448346 9:86688593-86688615 CCCCTTCCTCCACATTCTTTTGG + Intergenic
1057043172 9:91862329-91862351 CCTCCTCCTCCTTTTTTTTTTGG - Intronic
1058232809 9:102450764-102450786 TTCCTTCTTCCTCTATTTTTTGG - Intergenic
1058248789 9:102665550-102665572 TTCCTTCCTCCTCTATTTTAAGG + Intergenic
1058558146 9:106192556-106192578 CTCCCTCCTTCTCTATTTTTTGG + Intergenic
1058604447 9:106705726-106705748 CCCTTTCCTCCTCTCTGTGTGGG + Intergenic
1058781437 9:108340173-108340195 CCCCTACTTCCTTTTTGTTTGGG - Intergenic
1058888584 9:109341891-109341913 CACCTTCCTCCTTTTTTTCTAGG - Intergenic
1059359218 9:113726866-113726888 CTCTTTCCTCCTCTCTTTCTTGG - Intergenic
1059428524 9:114236253-114236275 CACCTTTCTCCTCTGATTTTGGG + Intronic
1059754353 9:117278525-117278547 CCCCTTCCCCCTCTTCATTCAGG + Intronic
1059808854 9:117833997-117834019 CCCCTTCCTATGCTTTTTTTAGG + Intergenic
1059966428 9:119619041-119619063 CCACTTCCTACACTTTTTATAGG + Intergenic
1060430165 9:123544199-123544221 GCCCTTCCTCCTCTTTTCCTGGG - Intronic
1060805260 9:126571604-126571626 CCCCTTTCAACTCTTTTATTTGG - Intergenic
1060913185 9:127367063-127367085 CCACTTCCTCCCATTTCTTTGGG + Intronic
1061638619 9:131932725-131932747 TTCCTTCCTCCTCTGTTTTTTGG - Intronic
1203736325 Un_GL000216v2:142919-142941 CCCCTTCCTCTTCGTTTCTCCGG + Intergenic
1185551817 X:988061-988083 CGCGTTCCTCCTCTTACTTTTGG - Intergenic
1185784727 X:2881113-2881135 CCACTTCCTCCTCTCTTCCTCGG - Exonic
1186560978 X:10613132-10613154 CCCCTTCCTCCGAATTGTTTGGG + Intronic
1186643748 X:11484265-11484287 CCCTGCCCTCCTCTCTTTTTTGG - Intronic
1186957640 X:14700725-14700747 CCACTTCTGCCTCTTTTTCTTGG - Intronic
1186967884 X:14808171-14808193 TTCCCTCCTCCTCTCTTTTTTGG - Intergenic
1187067776 X:15856770-15856792 CCCCTACCCCCACCTTTTTTTGG - Intergenic
1187215224 X:17269357-17269379 TCCCTTCCTCTTCCCTTTTTCGG - Intergenic
1187315363 X:18188732-18188754 TTCCTTCCTCCTCTATTTTTGGG - Intronic
1187655116 X:21463365-21463387 CCCCTGCCCCCTCTATTTTTTGG + Intronic
1187801798 X:23071898-23071920 GTCCTTCTTCCTCTGTTTTTTGG - Intergenic
1187803974 X:23097658-23097680 GTCCTTCCTCCTCGGTTTTTTGG - Intergenic
1188042905 X:25390841-25390863 CCCCTTCCCCTTCTTTTTCCAGG + Intergenic
1188437446 X:30178091-30178113 CTCCTTTCTCATCTTCTTTTTGG + Intergenic
1188444489 X:30242254-30242276 CCTCTTCCTCATCTGTTTTGAGG + Exonic
1188544145 X:31284593-31284615 CTTCTTCTTCTTCTTTTTTTTGG + Intronic
1189019905 X:37324314-37324336 TTCCCTCCTCCTCTATTTTTTGG - Intergenic
1189211069 X:39283252-39283274 CCCCTTTTTCCTTTCTTTTTAGG + Intergenic
1189548012 X:42063088-42063110 GTCCTTCCCCCTCTATTTTTTGG + Intergenic
1189890333 X:45594812-45594834 CCTCTTTCTCTTCTTTTTTAAGG + Intergenic
1191104480 X:56764117-56764139 CCCCTACCTGCCCTTTTTTTCGG - Intergenic
1191118764 X:56880446-56880468 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
1191645533 X:63477175-63477197 CCTCCTCCTCCTCAATTTTTTGG - Intergenic
1191811430 X:65193194-65193216 TTCCTTCCTCCTCAATTTTTTGG + Intergenic
1192137976 X:68622717-68622739 TCCCCTCCTCCTCTATTTCTTGG + Intergenic
1192243868 X:69357619-69357641 CCCCTTTCTCCTCTCTTTCAAGG - Intergenic
1192685170 X:73296640-73296662 GGCCTTCTTCCTCATTTTTTTGG - Intergenic
1192844741 X:74894445-74894467 TTCCTTCCTCCTTTATTTTTTGG - Intronic
1192892241 X:75402838-75402860 GTCCTTCCTCCTCATTTTTCTGG - Intronic
1192962366 X:76144385-76144407 CGCATTCCTCCTCTTACTTTTGG - Intergenic
1192963167 X:76150702-76150724 CGCATTCCTCCTCTTACTTTTGG + Intergenic
1193455577 X:81727685-81727707 ATCCCTCCTCCTCATTTTTTTGG - Intergenic
1193609938 X:83619211-83619233 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
1193631522 X:83894242-83894264 TCCCTTTCTCCTGTTTTTTTTGG + Intergenic
1193663843 X:84290991-84291013 TTCCTTCCCCCTCTGTTTTTTGG + Intergenic
1194121424 X:89967988-89968010 GTCCTTCCTCCTCTATTTTTTGG + Intergenic
1194137453 X:90163978-90164000 GTCCTTCCTCCTCAATTTTTTGG - Intergenic
1194218447 X:91162308-91162330 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
1194407933 X:93520889-93520911 CACCTTTCTCCTCTTACTTTTGG - Intergenic
1194864607 X:99050342-99050364 GCCTTTCCTCCTCAATTTTTTGG + Intergenic
1194937311 X:99966345-99966367 GTCCCTCCTCCTCTATTTTTTGG + Intergenic
1195122626 X:101771166-101771188 TTCCTTCCTCCTCTATTTCTCGG + Intergenic
1195789653 X:108569530-108569552 CCCCTTTCTCCTTTTCCTTTAGG + Intronic
1196015272 X:110933226-110933248 CACCTTCCTCTTCTTTTTGTAGG - Intergenic
1196358761 X:114827364-114827386 CTCCTTTATCCTCCTTTTTTTGG + Intronic
1196392783 X:115226122-115226144 CCCCCTCCTCCTTTTTCTCTTGG - Intronic
1196532269 X:116802348-116802370 TTCCTTCTTCCTCTATTTTTTGG + Intergenic
1196577651 X:117338835-117338857 CTCCTTCCTCCTTAGTTTTTTGG + Intergenic
1196578820 X:117355061-117355083 TTTCTTCCTCCTCTATTTTTTGG + Intergenic
1196777641 X:119354916-119354938 TTCCTTTCTCCTCTGTTTTTGGG - Intergenic
1196922458 X:120598761-120598783 TTCCCTCCTCCTCTATTTTTTGG - Intronic
1196975734 X:121155784-121155806 CACATTCCTCCTCTTACTTTTGG + Intergenic
1197308286 X:124871149-124871171 CCCCTTCCTCCTCCCCTGTTTGG + Intronic
1197341274 X:125268758-125268780 TTCCTTCCTTCTCTATTTTTTGG + Intergenic
1197343856 X:125307902-125307924 CCCTTTCCTCCTCCTTTTTCTGG - Intergenic
1197508435 X:127339018-127339040 CTCCCTACTCCTCTATTTTTTGG + Intergenic
1197804286 X:130384520-130384542 CTCATTCCTCCTCTTTCTCTCGG - Exonic
1198590703 X:138177568-138177590 CACCTTAGTCCTCTATTTTTAGG - Intergenic
1198629774 X:138623335-138623357 CTCCTTCCTCTTCATTTTTTTGG + Intergenic
1198974772 X:142324012-142324034 GTCCTTCCTCCTCAATTTTTTGG + Intergenic
1199114343 X:143972903-143972925 GTCCTTCATCCTCTGTTTTTTGG + Intergenic
1199393629 X:147309295-147309317 CGCGTTCCTCCTCTTACTTTCGG + Intergenic
1199457619 X:148046537-148046559 TCCCTTGCTCTTCTTTTCTTAGG + Intergenic
1200119526 X:153783768-153783790 CATCTTCTTCCTCTTGTTTTTGG - Exonic
1200286738 X:154830077-154830099 CCCCTTTCTCCTCTGCTCTTAGG - Intronic
1200420654 Y:2962840-2962862 CACCTTACTCCCCCTTTTTTTGG - Intronic
1200449240 Y:3303952-3303974 CACCCTCCTCTTCTATTTTTTGG - Intergenic
1200483183 Y:3733909-3733931 GTCCTTCCTCCTCAATTTTTTGG - Intergenic
1200554959 Y:4626068-4626090 TTCCCTCCTCCTCTATTTTTTGG + Intergenic
1201183691 Y:11376186-11376208 ATCCTTCCTCCTCCATTTTTTGG - Intergenic
1201395486 Y:13543338-13543360 CCTCCTCCTCCTCCATTTTTTGG - Intergenic
1201554790 Y:15256676-15256698 CCCCTTTTCCCTCTTCTTTTGGG - Intergenic