ID: 1064191816

View in Genome Browser
Species Human (GRCh38)
Location 10:13213023-13213045
Sequence TATTCAGGACACCCCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064191816_1064191819 15 Left 1064191816 10:13213023-13213045 CCAGTTTGGGGGTGTCCTGAATA No data
Right 1064191819 10:13213061-13213083 TTCAGGTATAAGTCTTTCTGTGG No data
1064191816_1064191818 -2 Left 1064191816 10:13213023-13213045 CCAGTTTGGGGGTGTCCTGAATA No data
Right 1064191818 10:13213044-13213066 TAAAGCTGCTATAAATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064191816 Original CRISPR TATTCAGGACACCCCCAAAC TGG (reversed) Intergenic
No off target data available for this crispr