ID: 1064199413

View in Genome Browser
Species Human (GRCh38)
Location 10:13272019-13272041
Sequence GGTGGGAGATGATATTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064199413_1064199419 3 Left 1064199413 10:13272019-13272041 CCATGAAAATATCATCTCCCACC No data
Right 1064199419 10:13272045-13272067 GCCCAAAGTAGGTCCTTCGTGGG No data
1064199413_1064199418 2 Left 1064199413 10:13272019-13272041 CCATGAAAATATCATCTCCCACC No data
Right 1064199418 10:13272044-13272066 AGCCCAAAGTAGGTCCTTCGTGG No data
1064199413_1064199414 -8 Left 1064199413 10:13272019-13272041 CCATGAAAATATCATCTCCCACC No data
Right 1064199414 10:13272034-13272056 CTCCCACCACAGCCCAAAGTAGG No data
1064199413_1064199423 29 Left 1064199413 10:13272019-13272041 CCATGAAAATATCATCTCCCACC No data
Right 1064199423 10:13272071-13272093 CAAGTTACACTAGAGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064199413 Original CRISPR GGTGGGAGATGATATTTTCA TGG (reversed) Intergenic
No off target data available for this crispr