ID: 1064202196

View in Genome Browser
Species Human (GRCh38)
Location 10:13294264-13294286
Sequence CTCTAAGAGCAGTGGTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064202191_1064202196 -8 Left 1064202191 10:13294249-13294271 CCTTTCCATATCCAGCTCTAAGA 0: 1
1: 0
2: 2
3: 11
4: 190
Right 1064202196 10:13294264-13294286 CTCTAAGAGCAGTGGTTCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1064202189_1064202196 17 Left 1064202189 10:13294224-13294246 CCCACTGATTTTACTCAATTCAA 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1064202196 10:13294264-13294286 CTCTAAGAGCAGTGGTTCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1064202190_1064202196 16 Left 1064202190 10:13294225-13294247 CCACTGATTTTACTCAATTCAAC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1064202196 10:13294264-13294286 CTCTAAGAGCAGTGGTTCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064202196 Original CRISPR CTCTAAGAGCAGTGGTTCCT GGG Intronic
904876712 1:33660725-33660747 CTCTAACAGAAGGGTTTCCTTGG - Intronic
905233757 1:36531127-36531149 CTCTAAGAGTTGGGGGTCCTGGG + Intergenic
905253026 1:36661858-36661880 GGCTAAGGGCAGTGGATCCTGGG + Intergenic
905455351 1:38084491-38084513 CTCTGAGAACAGTTGTTCCTGGG - Intergenic
905945583 1:41898842-41898864 ATCTAAGAGCGCTGGTTCCCAGG + Intronic
912686580 1:111772494-111772516 CTCTGAGAGCAGTGATGCTTTGG - Intronic
912810418 1:112789988-112790010 CACTAACAGCAGTAGTTGCTGGG - Intergenic
919493386 1:198233957-198233979 CTCTGAAAGCAGTCTTTCCTTGG + Intronic
920299717 1:204981243-204981265 CTCCAAGAGGACTGATTCCTGGG + Intronic
922183666 1:223255989-223256011 CTCTAATAGCAGTGGCCACTTGG + Intronic
922188840 1:223299299-223299321 CTTTGAGAACACTGGTTCCTAGG - Intronic
922198292 1:223379013-223379035 CTTTAGGAACAGTTGTTCCTGGG - Intergenic
923318055 1:232800933-232800955 CTCTAAGAGCTAAGGTTCCCAGG + Intergenic
923857652 1:237862388-237862410 CTCTATGTACAGGGGTTCCTGGG + Intergenic
924074513 1:240319374-240319396 CCCTTAGAACACTGGTTCCTTGG + Intronic
1063620980 10:7648964-7648986 CAGTAAGAGCAGGGGCTCCTGGG - Intronic
1064034224 10:11902174-11902196 CTCTTACAGCAGTGATCCCTGGG - Intergenic
1064202196 10:13294264-13294286 CTCTAAGAGCAGTGGTTCCTGGG + Intronic
1067234243 10:44435066-44435088 CCCAAAGAGCAGAGGTCCCTGGG - Intergenic
1068224888 10:54094908-54094930 GTCTAAGAACACTGCTTCCTTGG - Intronic
1068727447 10:60319314-60319336 CTCTATGAGCATTGGTTTCCTGG - Intronic
1069873777 10:71549163-71549185 CTCCAAGAGCTGGGGCTCCTTGG + Intronic
1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG + Exonic
1074280659 10:112048608-112048630 CTCCAAGGGTAGTGGGTCCTGGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075954139 10:126507768-126507790 CTCTAAGAACACTGATGCCTGGG - Intronic
1078900692 11:15639696-15639718 CTGTAATAGCAGTGGCTCCAAGG - Intergenic
1084421683 11:69063609-69063631 CTCTGAGAGCCCTGGGTCCTTGG + Intronic
1084741660 11:71143944-71143966 TCCTAAGAGCAGTGCTTTCTCGG - Intronic
1084955009 11:72686430-72686452 CTCTAAGAGAAATGTTTTCTTGG - Intronic
1088913026 11:114206373-114206395 GTCTAAGACCAGGGATTCCTGGG - Intronic
1090654627 11:128833439-128833461 CTCAAAGAGCTGTTGGTCCTGGG + Intergenic
1091058496 11:132440593-132440615 CTCCAAGAACAGTGAGTCCTTGG - Intronic
1092008596 12:5089493-5089515 CTGCAAGAGCAGTGTTCCCTGGG - Intergenic
1095876860 12:47088924-47088946 CTCTAAGAACCTTGGCTCCTTGG + Intronic
1099975600 12:89542720-89542742 CTCTAAGATCTCTGGTTCCTTGG - Intergenic
1101188546 12:102307053-102307075 CTCTAAGAGCCTGGATTCCTTGG + Intergenic
1101728205 12:107405310-107405332 CACTTAGAGCAGTGTTACCTTGG + Intronic
1104041328 12:125133275-125133297 CTCTAAGGAGAGAGGTTCCTTGG - Intronic
1106140834 13:27009969-27009991 CTCCAAAAGCCCTGGTTCCTAGG + Intergenic
1106578763 13:30999928-30999950 CCCCAACAGCAGTGGTTTCTGGG - Intergenic
1112409987 13:99154672-99154694 CTTAAAGAAAAGTGGTTCCTTGG + Intergenic
1112446315 13:99467711-99467733 CTTTAAGAGCAGTAGATCCTGGG - Intergenic
1114148903 14:20011797-20011819 CTCTAAGCGCAGACATTCCTGGG - Intergenic
1114217510 14:20667801-20667823 CTCTAAGCCCAGTGGTCCATGGG - Intergenic
1115192080 14:30756546-30756568 CGCAGAGAGCAGTGCTTCCTGGG + Intergenic
1115228452 14:31130239-31130261 CTCAAAGTTCAGTGGTTCCTTGG + Intronic
1115746828 14:36446636-36446658 CTCTCTGAGCCTTGGTTCCTTGG - Intergenic
1117002605 14:51386311-51386333 CTCCAACAGCTGTGGTTCATTGG - Intergenic
1122116580 14:99530608-99530630 GACAAAGAGCAGCGGTTCCTTGG + Intronic
1122708149 14:103634596-103634618 GTCTAAGAGGAGAGGGTCCTGGG + Intronic
1124005380 15:25791800-25791822 CTCTAAGAGCCATGGTTTGTCGG + Intronic
1124649454 15:31464311-31464333 CTCTGATAGCAGCTGTTCCTTGG + Intergenic
1125166714 15:36714742-36714764 GCCTGAGAGCAGTGGTTCATGGG - Intronic
1126152426 15:45535635-45535657 CTCTAACAGCTGGGGCTCCTTGG + Intergenic
1126217953 15:46178316-46178338 GTCTAATAGCATTGCTTCCTTGG - Intergenic
1128555141 15:68626625-68626647 CTCTAGAAGCAGTGATTCCCGGG - Intronic
1128930906 15:71704194-71704216 CTCTAAGAAAACTGGTTTCTTGG - Intronic
1130670830 15:85911005-85911027 CTCTGACATCAGTGTTTCCTGGG + Intergenic
1138084549 16:54121841-54121863 CTCTAAGAGCCGGGGCTTCTGGG - Exonic
1139274222 16:65712260-65712282 CACTAAGAGGTGGGGTTCCTGGG - Intergenic
1143895287 17:10131184-10131206 CTCGAAGAGCAGCGCTTACTTGG + Intronic
1144112520 17:12049839-12049861 CTCAGGGAGCTGTGGTTCCTTGG + Intronic
1146421960 17:32695287-32695309 CTGTAAGATCAGTGGCTCATTGG - Intronic
1148902007 17:50885283-50885305 CTCTCTGAGCAGAGGTTGCTGGG + Intergenic
1164606031 19:29598735-29598757 CTCTAGCACCAGTGGTACCTGGG + Intergenic
1164746889 19:30622925-30622947 CTCTAGGAGGAGTGGGTTCTGGG - Intronic
1165883124 19:39057432-39057454 ATCTAAGAGCAGTGGACACTGGG + Intergenic
1168171438 19:54592535-54592557 CTCTAAGTACAGTTGTTCTTTGG - Intronic
925853000 2:8101737-8101759 CATTAAGAGCAGTGCTTTCTTGG + Intergenic
927433745 2:23049146-23049168 CTCTAAGTGGAGAAGTTCCTCGG + Intergenic
928333868 2:30378708-30378730 CTGTATTAGCAGTGATTCCTAGG - Intergenic
932381971 2:71292412-71292434 CCCTCAGATCAGTAGTTCCTAGG - Intronic
934029800 2:88033024-88033046 CTATAATAACAGTGGTTGCTTGG + Intronic
935209271 2:100924397-100924419 CACAAAGATCAGTGGTTGCTAGG - Intronic
935427994 2:102941493-102941515 CTCAAAGAGCAGTTGATCTTTGG + Intergenic
936551435 2:113445362-113445384 CTCTAAGTACAGTTGTCCCTTGG + Intronic
938954963 2:136288771-136288793 TTCTAAGAGCAGATGTCCCTTGG - Intergenic
939129789 2:138221389-138221411 CCCTAAGAACAGTGGTAACTTGG - Intergenic
940790078 2:158022961-158022983 GTCTCAGAGCAGTGGCACCTGGG + Intronic
940892598 2:159049425-159049447 GTATAATAACAGTGGTTCCTGGG + Intronic
941442710 2:165557801-165557823 CCCTAAGGGCAGAGGTTTCTAGG - Intronic
942786531 2:179707998-179708020 CAATAAGAGCAGTGGTTGCCAGG + Intronic
945265634 2:207888797-207888819 CTCTAAGAGAAATAGGTCCTAGG - Intronic
945885907 2:215375248-215375270 CTCCCAGAGAAGTGGTCCCTCGG - Exonic
946321652 2:218958286-218958308 CCCTGACAGCAGTGGATCCTTGG + Intergenic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
1169197728 20:3692502-3692524 CTCTGTGAGCAGAGGGTCCTTGG - Exonic
1175537724 20:59726515-59726537 CTATAAGAGCAGGGGTTTCCAGG - Intronic
1178194579 21:30329201-30329223 CTCTAAGACCAGTGAATCCTGGG + Intergenic
1179168125 21:38951285-38951307 CTCTAACATCTGTGGTTCTTAGG - Intergenic
1181449849 22:23012447-23012469 CACTTAGAGCTGTGGTTCCAGGG - Intergenic
1181945257 22:26512099-26512121 CCCTATGAGCAGTGGAACCTAGG - Exonic
1182908148 22:33956487-33956509 CTCTGAGAGCACTGCCTCCTTGG + Intergenic
1183458977 22:37938129-37938151 CCCAAATAGCAGTGCTTCCTGGG + Intronic
1184987660 22:48146468-48146490 CATTAAGAGAAGGGGTTCCTGGG - Intergenic
949358194 3:3203706-3203728 TACTTAGAGCAGTGGTTCCTGGG - Intergenic
951696225 3:25448375-25448397 CCTTCAGAGCAGTGATTCCTAGG - Intronic
953080250 3:39609970-39609992 CTCTATTAACAGTGGTTACTTGG + Intergenic
954289070 3:49639570-49639592 CTCTAAGAACAGTGATGCCGAGG - Intronic
958550405 3:95605320-95605342 ATCTAAGAGCAGGTGTTCCAAGG + Intergenic
963010913 3:140769524-140769546 CACAAACAACAGTGGTTCCTGGG + Intergenic
964356569 3:155856341-155856363 CTCTAACAGTAGTTGTGCCTTGG + Intergenic
969185302 4:5469911-5469933 CTCTTTGAGCAGAAGTTCCTGGG - Intronic
970959862 4:21859048-21859070 ATCTAAGAGCAGTGATTTCGAGG - Intronic
972089500 4:35263412-35263434 ATATATGAGCAGTGGTTACTTGG - Intergenic
973775373 4:54236867-54236889 CTCTGATAACAGTGGTTCCCTGG - Intronic
983822474 4:172212641-172212663 ATATAAGAGCAGTGGTTGCCAGG - Intronic
984752460 4:183291170-183291192 CTACGAGAGCAGTGCTTCCTGGG + Intronic
985179795 4:187246272-187246294 CTCTCAGCACAGTGCTTCCTGGG + Intergenic
985721878 5:1493747-1493769 CTCCCAGAGCAGTGGGTCCATGG + Intronic
992696799 5:79297314-79297336 ATCTGAGAGCAGTGCTTCCCTGG - Intronic
993326579 5:86546137-86546159 CTCCAGGAGGAGTGCTTCCTTGG - Intergenic
993856652 5:93084536-93084558 TTATTTGAGCAGTGGTTCCTAGG + Intergenic
1001789633 5:174444897-174444919 CTGGAAGAGCAGTGGCTCCTGGG + Intergenic
1002833825 6:848708-848730 CTCTTAGAGCTGTGGTTTCTGGG - Intergenic
1006988319 6:38192067-38192089 CTCTTAAACCAGAGGTTCCTCGG + Intronic
1007174241 6:39885342-39885364 CTCTTTGAGCACTGGCTCCTGGG + Intronic
1009777468 6:68222983-68223005 CTCTAAGAAGACTGGTACCTCGG + Intergenic
1012377661 6:98581763-98581785 CAGTCAGAGCAGTGCTTCCTGGG + Intergenic
1014943538 6:127471103-127471125 ATCTAAGAGTAGTGGTTCTGGGG + Intronic
1018638037 6:165882081-165882103 CACTTAGATCAGTGGTTCTTTGG - Intronic
1018715862 6:166532363-166532385 CTCTAGGAGCAGGGGCTGCTAGG + Intronic
1020039443 7:4990675-4990697 CCCAAAGAGCAGTGCTTCCATGG - Intronic
1020566188 7:9798822-9798844 CGCAAAGACCAGTGGTTGCTAGG + Intergenic
1023599693 7:41869448-41869470 CTCTCAGAGCTGAGTTTCCTGGG + Intergenic
1023712299 7:43008008-43008030 CTCTAAACACAGAGGTTCCTTGG + Intergenic
1028708941 7:93884760-93884782 TCCTAAGAGCACTGGTTCTTAGG + Intronic
1033432465 7:141301631-141301653 TTCCAAGAGCAGTGTTTCGTAGG + Intronic
1035952894 8:4043642-4043664 TTCTAGGAGTGGTGGTTCCTGGG + Intronic
1037532582 8:19791996-19792018 CTCAAGGAGCCCTGGTTCCTTGG - Intergenic
1039426687 8:37492348-37492370 CTTTAGATGCAGTGGTTCCTCGG + Intergenic
1042805469 8:72766303-72766325 CTTTCAGAGCAGTGATTCTTTGG - Intronic
1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG + Intergenic
1049246666 8:141566423-141566445 CTCCAAGAGCATTGGAGCCTGGG + Intergenic
1049901560 9:171752-171774 CTCTAAGTACAGTTGTCCCTTGG - Intronic
1053744590 9:41182046-41182068 CTCTAAGTACAGTTGTCCCTTGG - Intronic
1054482681 9:65683164-65683186 CTCTAAGTACAGTTGTCCCTTGG + Intronic
1055794248 9:79957311-79957333 TTCTGAGACCAGTGGTTTCTGGG + Intergenic
1056072358 9:83000867-83000889 CTAGGAGAGCAGTGGTTTCTGGG + Intronic
1186550189 X:10496505-10496527 CTCTCACAGCTGTGGTTTCTGGG - Intronic
1189727216 X:43979594-43979616 CTAAAAGATCAGTGGTTGCTAGG + Intergenic
1190535815 X:51426553-51426575 TTCCAAGACCATTGGTTCCTTGG - Intergenic
1192017868 X:67351215-67351237 CTCTAACAGCAGTAGGGCCTAGG - Intergenic
1192499012 X:71636419-71636441 CCCAAAGAGGAGTGGTCCCTTGG + Intergenic
1194664258 X:96660187-96660209 TTCTTTGAGCAGTGGTTTCTAGG - Intergenic
1194931651 X:99895729-99895751 CTCTAAAAGCTGAGGGTCCTGGG + Intergenic
1198086258 X:133285621-133285643 TTCTAAGGACAGAGGTTCCTTGG + Intergenic