ID: 1064205417

View in Genome Browser
Species Human (GRCh38)
Location 10:13319893-13319915
Sequence CTGTGTAGGGGTAAGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064205411_1064205417 -1 Left 1064205411 10:13319871-13319893 CCTATTCGTGAACCACATAACAC 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1064205417 10:13319893-13319915 CTGTGTAGGGGTAAGGTGTTTGG No data
1064205410_1064205417 22 Left 1064205410 10:13319848-13319870 CCAACTTTCAACTGTGAAAATGA 0: 1
1: 0
2: 1
3: 34
4: 424
Right 1064205417 10:13319893-13319915 CTGTGTAGGGGTAAGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064205417 Original CRISPR CTGTGTAGGGGTAAGGTGTT TGG Intronic
No off target data available for this crispr