ID: 1064205587

View in Genome Browser
Species Human (GRCh38)
Location 10:13321122-13321144
Sequence GGGGCAAGGGACCACAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064205587_1064205595 0 Left 1064205587 10:13321122-13321144 CCAGCACTGTGGTCCCTTGCCCC 0: 1
1: 0
2: 1
3: 17
4: 259
Right 1064205595 10:13321145-13321167 GGCCTACTACGGAATCTCCCAGG No data
1064205587_1064205599 21 Left 1064205587 10:13321122-13321144 CCAGCACTGTGGTCCCTTGCCCC 0: 1
1: 0
2: 1
3: 17
4: 259
Right 1064205599 10:13321166-13321188 GGCAGCCTTCACAGATGCTGAGG No data
1064205587_1064205601 27 Left 1064205587 10:13321122-13321144 CCAGCACTGTGGTCCCTTGCCCC 0: 1
1: 0
2: 1
3: 17
4: 259
Right 1064205601 10:13321172-13321194 CTTCACAGATGCTGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064205587 Original CRISPR GGGGCAAGGGACCACAGTGC TGG (reversed) Intronic
900464897 1:2820789-2820811 GAGGCAGGGGGCCAAAGTGCTGG + Intergenic
900712407 1:4122686-4122708 GGGGCAAGGGATCTCAATGGAGG - Intergenic
900939464 1:5788857-5788879 GGGACCTGGGACCTCAGTGCAGG - Intergenic
901587749 1:10312344-10312366 GGTCCAAGCCACCACAGTGCTGG + Intronic
902203971 1:14853766-14853788 GGGCCAAGTGACCACAGGTCAGG - Intronic
902488479 1:16763711-16763733 GGGGCATGGGAGCCCAGGGCAGG - Intronic
902603609 1:17556279-17556301 GGGGCCTGGGAGCACAGGGCGGG + Intronic
903269075 1:22176600-22176622 GGGGCAAGGGGGCATAGAGCGGG + Intergenic
903767117 1:25742007-25742029 GAGGCAAAGCCCCACAGTGCAGG + Intronic
903925546 1:26828163-26828185 TGTGCAAGGAATCACAGTGCAGG - Intronic
904431725 1:30468679-30468701 GGGGCAGGGGTCCACGGTGAGGG + Intergenic
904894662 1:33805430-33805452 GGTGCCTGGAACCACAGTGCTGG - Intronic
905013392 1:34761742-34761764 GGGGCAAGGCTCCACGGAGCAGG - Exonic
905291653 1:36925784-36925806 GAGGCAAGGGTGCTCAGTGCTGG + Intronic
907051308 1:51331203-51331225 GGGGAAAGGGGCCAGAGTGTTGG - Intronic
909994788 1:82265991-82266013 GGGGCAAGAGATCACAGGGCAGG + Intergenic
915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG + Intronic
915940932 1:160117757-160117779 GGGGGAAGGGACGACACTGGTGG + Intronic
917795430 1:178529525-178529547 GGGCAAAGGGAGCAAAGTGCTGG - Intronic
917978222 1:180253748-180253770 GGGTCAAGGGGCCACACGGCAGG - Intronic
920976342 1:210789197-210789219 GGAGCAATGCACCACAGTGATGG + Intronic
923524370 1:234760660-234760682 AGGCCAGGGCACCACAGTGCAGG + Intergenic
923531960 1:234818805-234818827 GGGGCAGGGGAGCCCAGGGCAGG + Intergenic
1064205587 10:13321122-13321144 GGGGCAAGGGACCACAGTGCTGG - Intronic
1064283508 10:13971820-13971842 GGGGCCAGGGACCAGAGGGTTGG - Intronic
1066455430 10:35568009-35568031 GGGACCAGGGACCACAGCACAGG - Intronic
1067037878 10:42932953-42932975 GGGGCGCGGGAGCACAGGGCTGG - Intergenic
1069839850 10:71332945-71332967 AGGGCAAGGGAGCGCAGCGCGGG - Intronic
1070530428 10:77332147-77332169 GGGGTAAGGGAACACAGAGGAGG + Intronic
1070765679 10:79054772-79054794 GGGGCAAGGGGTCACAGGGAAGG + Intergenic
1074543926 10:114387895-114387917 AGGACACGGGACCACAATGCAGG + Intronic
1075005014 10:118823829-118823851 TGGGCAAGGGACCACTGCGTAGG + Intergenic
1075906021 10:126082842-126082864 GGGGCAGGGGACCACAGTGTGGG + Intronic
1077111227 11:863109-863131 TGGGGAAGGGGCCACAGTGGGGG - Intronic
1078093194 11:8280331-8280353 AGGGCAAGAGAACACAGTGAAGG + Intergenic
1078670893 11:13364218-13364240 GGGGCAAGGGATGACAGTGAGGG - Intronic
1080132996 11:28818325-28818347 GGGACAAGGGACCTAAGAGCAGG - Intergenic
1083147838 11:60772187-60772209 TGGACAGGGGACCAGAGTGCTGG + Intronic
1083547979 11:63563143-63563165 GTGGGAAGGAACCACGGTGCTGG - Intronic
1084049310 11:66589027-66589049 GGGTCATGGGACAACAGTGGAGG - Intergenic
1084103432 11:66965092-66965114 GGAGCCTGGGAACACAGTGCAGG + Intergenic
1084227309 11:67725306-67725328 TGGGAAAGATACCACAGTGCGGG - Intergenic
1084358279 11:68653443-68653465 GGGGCCAGGGTCCTCAGTGCTGG + Intergenic
1084393006 11:68890853-68890875 AGGGGCAGGGATCACAGTGCAGG - Intergenic
1084571236 11:69961173-69961195 TGGGGCAGGGAGCACAGTGCAGG + Intergenic
1084847581 11:71912429-71912451 TGGGAAAGATACCACAGTGCGGG + Intronic
1084959239 11:72707564-72707586 GGGGCAGGGGAGCCCAGTGGGGG + Intronic
1087056956 11:93946149-93946171 GGGTCATGGGACAACAGTGGAGG + Intergenic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089240014 11:117069594-117069616 GGGGTAAAAGACCACAGAGCAGG - Intronic
1089502743 11:118941813-118941835 GGGGCTAGAGAACACAGTGGGGG - Intronic
1090042442 11:123302543-123302565 ATGGCTAGGGACCACTGTGCTGG - Intergenic
1090976994 11:131687368-131687390 GGGACACGGGACATCAGTGCTGG + Intronic
1091637550 12:2208939-2208961 TGGGGCAGGGATCACAGTGCTGG - Intronic
1092097202 12:5852698-5852720 GGGGCAGGTGATCACAGTGGTGG + Intronic
1092289549 12:7150993-7151015 GGGGCTGGTGACCACGGTGCAGG - Exonic
1094687037 12:32728091-32728113 GGGGAAAGGGTACACAGTGGAGG - Intronic
1095412180 12:41936386-41936408 GGCCCCAGGGAACACAGTGCTGG - Intergenic
1096070925 12:48775182-48775204 TGGAGAAGGGACCACAGAGCAGG - Intronic
1097054987 12:56243800-56243822 GAGTCATGGGGCCACAGTGCTGG - Exonic
1097520710 12:60667021-60667043 GTGGCAACAGACCACAGTGTTGG + Intergenic
1098006600 12:66003763-66003785 GGGGTCAGGGGCCAGAGTGCAGG - Intergenic
1100242731 12:92726120-92726142 GAGGCAAGAGACGAAAGTGCAGG + Intronic
1101821853 12:108190553-108190575 GAGGTAAGGAACCACAGGGCAGG + Intronic
1102145417 12:110651455-110651477 GGGACAAGGAACCACAGTCAGGG + Intronic
1102174480 12:110866380-110866402 GGGTCATGGGACCATAGTGGAGG + Intronic
1102713774 12:114952404-114952426 GGTGCAGGAGACCACACTGCGGG - Intergenic
1102938261 12:116915525-116915547 GGTGGAAGGGAACACAGGGCAGG - Intronic
1106287386 13:28329511-28329533 GAGGCGAGGAAGCACAGTGCGGG + Intronic
1108648530 13:52453343-52453365 GAGGTAATGGACCACAGTGTTGG - Intergenic
1109622331 13:64925911-64925933 GGGGCCAGGGTCCAGAGTGGCGG + Intergenic
1110643586 13:77854937-77854959 GGGGCAAGGGACAAGAGGGCAGG + Intergenic
1112576640 13:100642210-100642232 AGAGCAAGGGATCACTGTGCTGG - Exonic
1112596932 13:100816020-100816042 TGGGCCAGGGACCACAGGGGAGG - Intergenic
1115510223 14:34131060-34131082 GGGGCAAAGGAGCTTAGTGCTGG - Intronic
1116958035 14:50944055-50944077 GGTGCAAGGGACCACTCTGAGGG + Intronic
1118147639 14:63157546-63157568 GGGGCAAGGTCCCACATAGCTGG + Intergenic
1118688853 14:68318713-68318735 GGGGCAAGGCCCAACAGTGCTGG - Intronic
1119086495 14:71743997-71744019 GGTGCAAGGGAGCACAATGCTGG - Intergenic
1120834821 14:89030106-89030128 GGGGCCAGGGAGCAGAGAGCAGG - Intergenic
1121327185 14:93028009-93028031 GGTGCATGGACCCACAGTGCCGG - Intronic
1121615118 14:95308613-95308635 GGGAGAGGTGACCACAGTGCAGG - Intronic
1122143094 14:99674028-99674050 GGGGCCAGGGGCCAGGGTGCAGG + Intronic
1122641136 14:103160386-103160408 GGAGCAGGGGATCCCAGTGCTGG + Intergenic
1122919619 14:104874646-104874668 GGGGGCAGGGACTACAGTGGAGG - Intronic
1123053689 14:105559667-105559689 AGGGGAGGGGATCACAGTGCTGG + Intergenic
1123078264 14:105680066-105680088 AGGGGAGGGGATCACAGTGCTGG + Intergenic
1202899781 14_GL000194v1_random:28370-28392 GGGGCGGGGGGCCACAGCGCCGG - Intergenic
1126349443 15:47729432-47729454 GGGCCAAGGGACCACTTTGGAGG + Intronic
1128582868 15:68821007-68821029 GGGGGAAGGGACCAATGGGCGGG + Intronic
1129038240 15:72664004-72664026 GGAGCAAGGGACCAGGGTCCTGG + Intronic
1129211648 15:74073227-74073249 GGAGCAAGGGACCAGGGTCCTGG - Intronic
1129398755 15:75267857-75267879 GGAGCAAGGGACCAGGGTCCTGG + Intronic
1129402363 15:75292133-75292155 GGAGCAAGGGACCAGGGTCCTGG + Intronic
1130311954 15:82764033-82764055 GCTGTAAGGTACCACAGTGCAGG + Intronic
1133025408 16:2987059-2987081 GGGCACAGGGACCTCAGTGCTGG + Intergenic
1133826145 16:9280018-9280040 GGGGCAAGGGACCTTAGCTCTGG + Intergenic
1136361772 16:29785185-29785207 AGGGAAAGGGAGCCCAGTGCTGG + Intergenic
1136362569 16:29790447-29790469 AGGGAAAGGGAGCCCAGTGCCGG + Intergenic
1136619412 16:31418214-31418236 GGGACAAGGGAGGACAGTGATGG - Intronic
1137236581 16:46623262-46623284 GGGGTCAGGGGCCAGAGTGCAGG - Intergenic
1138087473 16:54145940-54145962 AGGGCAAGGGACCAGTGTCCAGG + Intergenic
1139215876 16:65123506-65123528 TGGGGAAGGAACCCCAGTGCGGG + Intronic
1140664395 16:77214392-77214414 GGGGCAGGGGACCACAGCCTGGG - Intergenic
1141842665 16:86584102-86584124 GTGGAAAGGAGCCACAGTGCTGG + Intergenic
1142112666 16:88340628-88340650 GGAGGAAGGAACAACAGTGCAGG + Intergenic
1142206127 16:88784169-88784191 GGGGCAGGGGTCCCCAGTCCTGG - Intronic
1142789947 17:2256116-2256138 GGGTCATGGGACAACAGTGGAGG - Intronic
1143569583 17:7747485-7747507 GAGGGAAGGGAACAAAGTGCGGG - Intronic
1146795150 17:35775274-35775296 GGGGCAAGGGCTCAGACTGCTGG - Intronic
1149446524 17:56717612-56717634 GGGAAAAGGGACCAGAGTGGAGG - Intergenic
1150574257 17:66416151-66416173 GAGGCAGGTGACAACAGTGCAGG - Intronic
1151519636 17:74618867-74618889 TGGTCAAGGGAGCACAGAGCGGG - Intronic
1152048998 17:77958440-77958462 GGTGCAGGGAACCACAGCGCGGG + Intergenic
1152380298 17:79938869-79938891 GATGCAAGAGACCACAGAGCAGG + Exonic
1152631031 17:81410775-81410797 GTGGGATGGGACCACAGAGCTGG + Intronic
1152700230 17:81814988-81815010 GGGCCCAGGGACCACACAGCGGG + Intergenic
1153061081 18:995629-995651 GGGTCAAGGGACAACAGAGTGGG + Intergenic
1155225518 18:23726143-23726165 GGGGCAAGGAAGCCCAGAGCCGG + Intronic
1155806245 18:30175120-30175142 GGGACCAGGCACCACAGAGCAGG + Intergenic
1156545138 18:37956765-37956787 GCAGCAAGGGACCACACAGCCGG - Intergenic
1157325941 18:46668955-46668977 GGGGTCAGGGACCATGGTGCTGG - Intronic
1157329139 18:46690494-46690516 GGGACAAGACAGCACAGTGCAGG - Intronic
1158518002 18:58146763-58146785 GGAGCAAGGGACCACACCGCAGG - Intronic
1161088056 19:2344161-2344183 GGGGCAGGGGAGCACGGTGTGGG - Intronic
1161139074 19:2637285-2637307 GGAGCAGGGGATCACGGTGCTGG + Intronic
1161148911 19:2696522-2696544 TGGGCAATGGAGCACAGTGCTGG - Intronic
1164129720 19:22350556-22350578 GGGGCAAGGTGACACAGTGTGGG + Intergenic
1165057968 19:33190743-33190765 GAGGCAAGGGACCACATGGAGGG + Intronic
1165393079 19:35549463-35549485 GGGAGAAGGGACCACACTGATGG + Intergenic
1166064862 19:40351689-40351711 GGGGCAAGAGACGACATTGGAGG + Intronic
1202702719 1_KI270713v1_random:529-551 GGGGCATGGGAGCCCAGGGCAGG + Intergenic
925151066 2:1615161-1615183 GGGGCCAGGGTGCAGAGTGCTGG + Intergenic
925976935 2:9148253-9148275 GCTGCAAGGGACCACAGAGGAGG - Intergenic
926652231 2:15358887-15358909 GGCTCAAGGGATCACAGTTCTGG + Intronic
926675891 2:15619329-15619351 GGGGCCAGGGTCCAGAGTGGTGG + Intronic
927661126 2:24993866-24993888 GGGAGAAGGGAACACAGAGCTGG + Intergenic
927679694 2:25131568-25131590 GAGGCAAGGGACAACAGGGAGGG + Intronic
927886325 2:26720994-26721016 GGGGCCAGAGGCCACAGTGAAGG + Intronic
927978869 2:27360172-27360194 GGGTCATGGGACAACAGTGGAGG - Intergenic
929565335 2:42980241-42980263 GGGGCACTGGAGCACAGTGTGGG + Intergenic
929614879 2:43298530-43298552 GGGTCATGGGACAACAGTGGAGG - Intronic
930317785 2:49818344-49818366 GGGGCAAGGGATCAATGTGTTGG + Intergenic
932659667 2:73641393-73641415 TTGGCAAGGAACCACAGGGCAGG + Exonic
932666230 2:73701070-73701092 TTGGCAAGGAACCACAGGGCAGG + Intergenic
933490991 2:82985734-82985756 GGGACCAGGCACCACAGAGCAGG + Intergenic
933698750 2:85239269-85239291 AGGGCAAAGGACCACAGGGAAGG - Intronic
936516762 2:113185913-113185935 GGGGCAGGGGGCCAAGGTGCAGG - Exonic
938242892 2:129756790-129756812 TGGGAAAGGGATCACAGTCCAGG + Intergenic
938682498 2:133705663-133705685 GAGGAAAAGGACCACAGTGTGGG + Intergenic
940954525 2:159712812-159712834 GGGCCAAGGGGCCACAGCGCAGG + Intronic
942610225 2:177735765-177735787 GTGGCCTTGGACCACAGTGCAGG + Intronic
944373648 2:199014286-199014308 GAGGGAAGGGACAACAGAGCGGG - Intergenic
945987237 2:216364656-216364678 GGGGCAAGGCACCACTGTTTTGG + Intronic
946025702 2:216670603-216670625 GGAGGAAAGGACCACAGTGGTGG + Intergenic
946249193 2:218402616-218402638 GGGGCGAGGGAGCACAGCACGGG - Intronic
947605206 2:231481602-231481624 TGGGCAAAGGACCCCAGTGTAGG + Intronic
949034767 2:241811378-241811400 GAGACAAGGGCCCACTGTGCGGG - Exonic
1172348724 20:34224151-34224173 GGGTCATGGGACAACAGTGGAGG - Intronic
1172667785 20:36612802-36612824 GAGGCCAGGCACCTCAGTGCTGG - Exonic
1173549295 20:43921263-43921285 GGGGCAAGGAGCCACACAGCAGG - Intronic
1174126269 20:48309254-48309276 GGGGCAAGGGGCCATGGTGAGGG - Intergenic
1175443794 20:59007245-59007267 GGGGCAGGGGCCCAAAGTGCGGG - Exonic
1175974120 20:62701869-62701891 GGTGCAGGGCACTACAGTGCAGG + Intergenic
1176035311 20:63033525-63033547 GGGGGAGGGGCCCACAGCGCTGG - Intergenic
1176266403 20:64211802-64211824 GGAGGGAGGGACCACAGTGGTGG + Intronic
1176619156 21:9043144-9043166 GGGGCGGGGGGCCACAGCGCCGG - Intergenic
1178671173 21:34592886-34592908 ATGGTAAAGGACCACAGTGCTGG + Intronic
1178931343 21:36821204-36821226 TGGGCAGGGGGCCACAGTGAGGG + Intronic
1179540859 21:42082593-42082615 GGGAGGAGGGACCCCAGTGCTGG - Intronic
1180184135 21:46131212-46131234 GGGGCCAGAGACCACAGGACAGG - Intronic
1181012880 22:20052653-20052675 GGGCCAAGGGACTACAGGACTGG + Intronic
1181980686 22:26763840-26763862 GGGGGAGAGGACCACAGCGCAGG + Intergenic
1182123723 22:27801900-27801922 GGCGCAGGGGACCCCAGAGCTGG - Intergenic
1183351255 22:37336005-37336027 AGTGCAAGGGACTTCAGTGCAGG - Intergenic
1183787214 22:40036714-40036736 GGGTCTAGGGGCCACAGTCCTGG + Exonic
1184236364 22:43185375-43185397 GGTGTAAGGGCCCACAGCGCTGG + Intronic
1184259253 22:43305403-43305425 AGGGCAAGGGAGCAGAATGCAGG + Intronic
1185188272 22:49416386-49416408 GGGTCATGGGACAACAGTGGAGG - Intronic
950032361 3:9861492-9861514 GGGGCAAGGGTCCTGAGAGCTGG + Intergenic
950415493 3:12866889-12866911 GGGGCAAGGGTCCTGAGAGCGGG + Intronic
952125317 3:30292926-30292948 GGGGAAAGTGGCCACAGTGTAGG - Intergenic
954156206 3:48686122-48686144 GGGGAAAGGGAGCAGAGGGCTGG - Intronic
954575697 3:51674848-51674870 GAGGCAGGGGACCAAAGTCCTGG - Intronic
954615912 3:51968441-51968463 GGGGGAGGGGCCCACAGTGTTGG + Intronic
954683892 3:52360256-52360278 GGGGCAATGGGCCACTGGGCAGG - Intronic
959683154 3:109118454-109118476 GCGGCAAGGCAGGACAGTGCGGG + Intergenic
959887661 3:111521093-111521115 GGGGCAAGAGAGCACAGCCCTGG + Intronic
960109612 3:113833034-113833056 GGGGCAAGGGATAACAGTTCAGG - Intronic
961503259 3:127352255-127352277 GCGGTAAGGGAACACAGTGCCGG + Intergenic
961749701 3:129087960-129087982 GGGGTCAGGGGCCAGAGTGCAGG - Exonic
969239526 4:5889420-5889442 GGGGCTGGTGTCCACAGTGCTGG - Intronic
969616476 4:8255846-8255868 GGGGCACGGGGCCACAGAGAAGG + Intergenic
970492904 4:16593700-16593722 GGGGCAAGGGAGCTCGGTTCAGG + Intronic
971399706 4:26264765-26264787 GGGTTATGGGAGCACAGTGCAGG - Intronic
972561706 4:40234515-40234537 GGGGAAGGGGACCACGGTCCCGG + Intronic
973346371 4:49060263-49060285 GGAGTCAGGGACCACAGGGCTGG + Intronic
973603154 4:52561578-52561600 GTGGGCTGGGACCACAGTGCAGG - Intergenic
974084515 4:57244954-57244976 AGAGAAAGGGAACACAGTGCAGG + Intergenic
977897984 4:102385410-102385432 GAGGCAGTGGACCACAGTACTGG - Intronic
978484834 4:109240554-109240576 GGGCCAATGGAGCACAGGGCTGG - Intronic
978539276 4:109799215-109799237 GGGGCAAAGGATTACAGTGGAGG - Intronic
981930103 4:150180705-150180727 GGGGTAAGAGACCAGAGGGCAGG - Intronic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
985510166 5:309052-309074 GTGGCAAAGGACCACAGCGGAGG - Intronic
985583314 5:711737-711759 GGGAAATGGGAGCACAGTGCTGG - Intronic
986771228 5:10975760-10975782 GGGGCCAGGGAAGGCAGTGCAGG + Intronic
986783462 5:11088290-11088312 GGGGAAACTGACCACAGTGGAGG + Intronic
988680380 5:33479356-33479378 GGGGCAAATGCCCAAAGTGCAGG - Intergenic
989439087 5:41448999-41449021 TGGGCAAGGAACCATAGTGTGGG - Intronic
989565352 5:42895977-42895999 GGGGCAGTGGACCACTGTGCTGG - Intergenic
990023678 5:51159771-51159793 GGGCCAAGGCAGCACAGGGCTGG - Intergenic
992535289 5:77695480-77695502 GAGGCAAAGGAACACAGTGATGG + Intronic
994197981 5:96940874-96940896 GGGACCAGGGACCACAGTCGGGG + Intronic
994766870 5:103929405-103929427 GAGGCAAGGGAGAATAGTGCAGG + Intergenic
997662729 5:135601844-135601866 TGAGCAAGGGAGCACACTGCTGG - Intergenic
998095326 5:139393055-139393077 GGGGCGGGGGGCCCCAGTGCTGG + Exonic
999823634 5:155253332-155253354 GGGGCAAGGGAGCTCAGTTCTGG + Intergenic
1000003613 5:157163325-157163347 AGGTCAAGTGACCACAGCGCTGG - Exonic
1001155843 5:169271941-169271963 TGGGCAAATGAGCACAGTGCTGG + Intronic
1001267598 5:170285922-170285944 GGGAGCAGGGAGCACAGTGCTGG - Intronic
1002014294 5:176306844-176306866 GGGTCATGGGACAACAGTGGAGG - Intronic
1002021658 5:176367547-176367569 GGGGCCAAAGACCACAGTGAGGG - Intronic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1002612898 5:180432886-180432908 GTGGAAAAGGACCCCAGTGCTGG - Intergenic
1002856774 6:1044808-1044830 AGGGCAAGGGAAGACAGTGCAGG + Intergenic
1004856000 6:19750466-19750488 GGGCCCAAGGACCACAATGCTGG + Intergenic
1007237778 6:40403409-40403431 GGGGCCAGGGACCAGAGGCCTGG + Intronic
1019685529 7:2379919-2379941 GGGGCTGGGGAGCAGAGTGCGGG + Intronic
1019925502 7:4189481-4189503 GGGGCTAAAGGCCACAGTGCTGG - Intronic
1021572880 7:22083234-22083256 GGGGCCAGCGCCCCCAGTGCCGG + Intergenic
1023851167 7:44151294-44151316 GGGACAAGGCAACACAGGGCAGG + Intronic
1023852004 7:44155682-44155704 GGGCCAAAGGACCAGAGTCCAGG - Intronic
1023873253 7:44273902-44273924 GAGGCCAGGGAGCACAGTCCGGG + Intronic
1023885098 7:44348734-44348756 GGGCCAAGGGAGCAAAGTGCAGG + Intergenic
1029980456 7:104873936-104873958 GGGGCAGGGGCCCACACTGGAGG + Intronic
1033015727 7:137669403-137669425 GGGGCAGGGACCCACAGTACTGG - Intronic
1034038801 7:147854623-147854645 GTGGCTAGGAACCACTGTGCTGG - Intronic
1034694134 7:153039115-153039137 GGGGTGAAGGACAACAGTGCTGG - Intergenic
1035283631 7:157792961-157792983 GAGGCAAGGGACCCCAGTTTGGG + Intronic
1037784168 8:21892808-21892830 GGGTCAAGGGACTGGAGTGCTGG - Intergenic
1037959203 8:23083862-23083884 GGGGACAGGGACACCAGTGCTGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038716241 8:29993832-29993854 GGGGCCAGGGAACAGAGTGGAGG - Intergenic
1038963759 8:32549042-32549064 AGGGCAAGGGACAGCAGTCCCGG + Intronic
1039881825 8:41629993-41630015 GGGGCAGGGGACCCCTATGCTGG + Intergenic
1040315986 8:46261184-46261206 GGGTGAAGGGACGACACTGCAGG + Intergenic
1040360732 8:46661893-46661915 GAGTCCAGGGTCCACAGTGCAGG + Intergenic
1040942263 8:52845466-52845488 GGGGCTAGGAACCAAAGTGGAGG + Intergenic
1044637825 8:94344186-94344208 GGGGTGAGGGACAACAGTGCAGG + Intergenic
1045347255 8:101304435-101304457 GGGGCAGGTGACCCCTGTGCTGG - Intergenic
1047679480 8:127239675-127239697 GTGGCAAAGGAGCATAGTGCTGG - Intergenic
1049514187 8:143044730-143044752 GGGGCACGAGACCACGCTGCAGG + Exonic
1053350848 9:37412395-37412417 GTGTCATGGGACCTCAGTGCAGG - Intergenic
1056552593 9:87664041-87664063 GGGGCAGGAGGCTACAGTGCAGG - Intronic
1056714132 9:89014281-89014303 GACCCCAGGGACCACAGTGCAGG - Intronic
1057193437 9:93100038-93100060 GGGGCTGGGGACCACGGTGATGG - Intronic
1057720357 9:97527452-97527474 GGTGCAAGGCATCACAGAGCAGG + Intronic
1058186486 9:101861353-101861375 GGGTTAAGGGACCACACAGCAGG + Intergenic
1060530099 9:124342954-124342976 GGGGCTGGGAACCACAGGGCCGG - Intronic
1060724037 9:125995671-125995693 GGGGAAAGGGGCCACTGTCCAGG - Intergenic
1060856399 9:126917083-126917105 GGGGCCAGGAACCATGGTGCTGG + Intronic
1061491103 9:130944650-130944672 CCGGGGAGGGACCACAGTGCTGG + Intergenic
1061503202 9:131015395-131015417 GGGACAAGGGGCCACAGGGAAGG - Intronic
1061601648 9:131674496-131674518 AGGGAGAGGGACCACAGTGGTGG - Intronic
1062500606 9:136850414-136850436 GGGCCCAGGGCCCAAAGTGCTGG - Intronic
1186434595 X:9532197-9532219 GGGGCAGGGGCTCCCAGTGCAGG - Intronic
1187203478 X:17158751-17158773 GGGGAAAGAAACCACTGTGCAGG + Intergenic
1189000763 X:36942086-36942108 GGGGCAGGGGACTAAAGTCCAGG - Intergenic
1189167756 X:38878163-38878185 AGGGGAAAGGACCAGAGTGCCGG - Intergenic
1191716325 X:64196195-64196217 GGAGCCATGGACCACAGGGCTGG + Intronic
1197151399 X:123223725-123223747 GGTGGAAGGGAGCACAGGGCAGG + Intronic
1197859014 X:130949844-130949866 GGGGCTAGTGAGCACAGTCCTGG + Intergenic
1199677617 X:150201070-150201092 GGAGGCAGGGACCACAGTTCCGG - Intergenic
1200054950 X:153455422-153455444 CTGACAAGGGACCACAGGGCAGG - Intronic
1200064218 X:153497052-153497074 GGTGCCAGGGACCCCAGGGCTGG - Intronic
1200081421 X:153578638-153578660 GGGGCAGAGGGCCACTGTGCCGG + Intronic
1200126275 X:153816369-153816391 GGTGCCAGGGACCCCAGGGCTGG + Intronic