ID: 1064208981

View in Genome Browser
Species Human (GRCh38)
Location 10:13347830-13347852
Sequence GAGAGGGGCAGCGCCGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 487}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064208981_1064209002 27 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064209002 10:13347880-13347902 CGCGGCTCCCCGGCGGTCCCGGG 0: 1
1: 0
2: 2
3: 12
4: 204
1064208981_1064209003 30 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064209003 10:13347883-13347905 GGCTCCCCGGCGGTCCCGGGCGG 0: 1
1: 0
2: 2
3: 17
4: 190
1064208981_1064208992 -6 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064208992 10:13347847-13347869 CCTCTCCAGGCAGGGCTGGCGGG 0: 1
1: 0
2: 3
3: 62
4: 523
1064208981_1064209001 26 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064209001 10:13347879-13347901 GCGCGGCTCCCCGGCGGTCCCGG 0: 1
1: 0
2: 2
3: 9
4: 202
1064208981_1064208996 2 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064208996 10:13347855-13347877 GGCAGGGCTGGCGGGGCCGGCGG 0: 1
1: 1
2: 25
3: 294
4: 1519
1064208981_1064208995 -1 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064208995 10:13347852-13347874 CCAGGCAGGGCTGGCGGGGCCGG 0: 1
1: 0
2: 11
3: 142
4: 1049
1064208981_1064209000 20 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064209000 10:13347873-13347895 GGCGGCGCGCGGCTCCCCGGCGG 0: 1
1: 0
2: 3
3: 30
4: 253
1064208981_1064208990 -7 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064208990 10:13347846-13347868 CCCTCTCCAGGCAGGGCTGGCGG 0: 1
1: 0
2: 4
3: 77
4: 609
1064208981_1064208997 9 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064208997 10:13347862-13347884 CTGGCGGGGCCGGCGGCGCGCGG 0: 1
1: 1
2: 8
3: 95
4: 641
1064208981_1064208993 -5 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064208993 10:13347848-13347870 CTCTCCAGGCAGGGCTGGCGGGG 0: 1
1: 0
2: 4
3: 30
4: 344
1064208981_1064208998 17 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064208998 10:13347870-13347892 GCCGGCGGCGCGCGGCTCCCCGG 0: 1
1: 1
2: 7
3: 37
4: 372
1064208981_1064208987 -10 Left 1064208981 10:13347830-13347852 CCAAGCCCGGCGCTGCCCCTCTC 0: 1
1: 0
2: 0
3: 38
4: 487
Right 1064208987 10:13347843-13347865 TGCCCCTCTCCAGGCAGGGCTGG 0: 1
1: 1
2: 6
3: 44
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064208981 Original CRISPR GAGAGGGGCAGCGCCGGGCT TGG (reversed) Intronic
900115181 1:1025228-1025250 GAGCTGGGCAGGGCCGGGCTGGG - Intronic
900144460 1:1151793-1151815 GAGCGGGGCAGCCCCAGGCTGGG - Intergenic
900243522 1:1627631-1627653 GAGAGGGAGGGCGCCGGGCCCGG - Intronic
900370919 1:2331812-2331834 GAGAGGCGCAGCGGCGGGAGAGG - Intronic
900370968 1:2331989-2332011 GAGAGGCGCAGCGGCGGGAGAGG - Intronic
900370972 1:2332006-2332028 GAGAGGCGCAGCGGCGGGAGAGG - Intronic
900576803 1:3386799-3386821 GGCAGGGGCACCGCGGGGCTGGG + Intronic
900961947 1:5928179-5928201 CAGAGGGGCAGGGCAGGGCAAGG - Intronic
901063729 1:6485376-6485398 CGGAGGGGCAGCCCCGGGCCCGG + Intronic
901086275 1:6613992-6614014 GAGCGGGGCCGCCCGGGGCTGGG - Exonic
901459858 1:9385040-9385062 GTGCGGGGCAGAGCCGGGCAGGG - Intergenic
901666685 1:10830291-10830313 GGAAGGGGCGGCGCCGGGGTGGG - Intergenic
901738763 1:11328844-11328866 GAAAGGGACAGTGCCGGGCCCGG - Intergenic
902940955 1:19799914-19799936 GGGAGGGGCCGGGCCGGGCCGGG - Exonic
902955932 1:19924060-19924082 GGGAGGGGAAGCGCCAGGCCAGG - Intergenic
903164080 1:21509131-21509153 GAGAGAGGAAGGGCTGGGCTGGG + Intergenic
903383202 1:22910599-22910621 AAGAGGGGCAGGGCCTGGCTGGG - Intronic
903384356 1:22916834-22916856 GAGCTGTGCAGCGCCAGGCTGGG + Intergenic
904048393 1:27623222-27623244 GGGAGGTGCAGCACCTGGCTGGG - Intronic
904329290 1:29747450-29747472 GAGATGGGCAGCCCTGGGCAGGG - Intergenic
904450275 1:30606433-30606455 GAGATGGGCAGAGCTGGGGTGGG + Intergenic
904467785 1:30718488-30718510 GAGAGAGTCAGCGCCGGGGCGGG - Intronic
904568317 1:31441900-31441922 GAGAGGAGGAGCCCTGGGCTGGG + Intergenic
904652253 1:32014242-32014264 GAGGGGGGCAGCAGCGGGGTCGG - Exonic
904904365 1:33883924-33883946 GAGCTGGGCAGGGCGGGGCTGGG + Intronic
905789841 1:40784076-40784098 GCCATGGGCGGCGCCGGGCTGGG - Exonic
906057158 1:42926421-42926443 GAGAGGGGAAGGGCCAGTCTGGG - Exonic
906590913 1:47023646-47023668 GGGAGGGGCAGCTCAGGCCTGGG - Exonic
907046874 1:51304963-51304985 GAGAGGGGCTGAGCCAGGATGGG + Intronic
907200956 1:52726547-52726569 GCGAGCGGCGGCTCCGGGCTTGG - Exonic
907306892 1:53518196-53518218 GACAGGGCCAGCACCGGGCCTGG + Intronic
907909853 1:58816171-58816193 GAGAGAGGCAGAGCCGGGGTTGG + Intergenic
909132074 1:71750281-71750303 GAAAGGAGCAGGGCCGGGCGCGG - Intronic
910251433 1:85201696-85201718 GCGAGGGCCAGCGCCGGTCATGG - Intergenic
910931026 1:92442759-92442781 GAGAGTGGCAGAGCTGGGATTGG + Intergenic
912915841 1:113813287-113813309 GAGACGGGCGGGGCGGGGCTCGG + Intergenic
913413688 1:118580997-118581019 GAGAAGGGCAGCCCTGGACTAGG + Intergenic
914777324 1:150749608-150749630 AAGAGGGGCAGGGCAGGGCAGGG - Intronic
914913275 1:151803123-151803145 GAGAGGGACAGAGCAGAGCTTGG - Intronic
915367887 1:155325521-155325543 GCGCAGGGCAGGGCCGGGCTTGG + Intronic
915491242 1:156251072-156251094 GACAGGGGCAGCTGGGGGCTGGG + Intronic
915537979 1:156548971-156548993 GAGGGAGGCAGCGTGGGGCTAGG + Intronic
916222707 1:162460791-162460813 GATAGGGACAGGGCCGGGCGCGG + Intergenic
916791874 1:168132303-168132325 GAGAGCCACAGCGCCCGGCTTGG - Intronic
917554188 1:176067224-176067246 GAGAGGGGCAGTGAAGTGCTGGG + Intronic
917755484 1:178094070-178094092 GAGCGGGGCCGGGCAGGGCTGGG - Intergenic
919730230 1:200908960-200908982 GAGAAGGGCAGGGCAGGGCAGGG + Intronic
919913447 1:202126117-202126139 TAGAAGGGCAGGGCCGGGCACGG + Intronic
920002332 1:202808253-202808275 CCGAGGGGCAGCGCCGGGCGCGG + Exonic
920886884 1:209938158-209938180 GAGAGGGGCGGGGCCCGGCCCGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922210357 1:223481494-223481516 GAGAGAGCCAGCGCTGGCCTGGG - Intergenic
922717980 1:227886882-227886904 GAGAGGCTCAGCGCCGGGGTGGG - Intergenic
922804720 1:228379347-228379369 GCAAGGGGCAGGGCGGGGCTCGG - Intergenic
924527065 1:244863030-244863052 GAGCGCCGCCGCGCCGGGCTCGG - Intronic
1062854003 10:770260-770282 GACAGGGGCAGCGGGGAGCTGGG + Intergenic
1062854032 10:770355-770377 GACAGGGGCAGCGGGGAGCTGGG + Intergenic
1064208981 10:13347830-13347852 GAGAGGGGCAGCGCCGGGCTTGG - Intronic
1066549782 10:36543990-36544012 AAGAGTGGCAGAGCCGGGCGTGG + Intergenic
1067045486 10:42982966-42982988 GGAAGGGGCAGGGCAGGGCTAGG - Intergenic
1067067253 10:43111007-43111029 GAACGGGGCAGGGCAGGGCTGGG + Intronic
1067118654 10:43455682-43455704 GAGAGTGGCAGGGCTGGGCGCGG + Intronic
1067375874 10:45727338-45727360 GAGAGGGGCCGGCCTGGGCTGGG + Intronic
1069710071 10:70482377-70482399 GACAGGGGCAGCACATGGCTGGG - Intronic
1069905698 10:71730899-71730921 GAGAGGGGCTGGGCAGAGCTGGG + Intronic
1070167691 10:73911076-73911098 GGGAGGGGCGGCGCCGGGGCGGG + Exonic
1070761386 10:79026529-79026551 GAGGTGGGCAGGGCCTGGCTGGG + Intergenic
1071730861 10:88247148-88247170 GAGGAGGGCAGAGCCTGGCTTGG + Intergenic
1073059748 10:100726314-100726336 GAGAGGGGCAAGGCCTGACTGGG + Intergenic
1073159021 10:101373625-101373647 AAGATGGGCAGGGCCGGGCGCGG + Intronic
1073254100 10:102140058-102140080 GTAAGGGGAAGCCCCGGGCTTGG + Exonic
1075709642 10:124523764-124523786 GAAAGGGCCAGTGCTGGGCTTGG + Intronic
1075721886 10:124592332-124592354 GACAGGGCCAGCCCGGGGCTGGG - Intronic
1076322822 10:129596086-129596108 GGGAGGGGCAGGGCGGGGCAGGG - Intronic
1076435577 10:130438946-130438968 GAGATGGAAAGAGCCGGGCTTGG + Intergenic
1076733305 10:132448700-132448722 GGGAGGGGCCGGGCCGGACTGGG - Exonic
1076733334 10:132448762-132448784 GGGAGGGGCCGGGCCGGACTGGG - Exonic
1076733376 10:132448855-132448877 GGGAGGGGCCGGGCAGGGCTGGG - Exonic
1076775799 10:132697362-132697384 GAGAGAGGCAGCGCGCGGCAGGG - Intronic
1076861470 10:133140140-133140162 GACAGGGGCAGCACGGGGCAGGG - Intergenic
1077093091 11:788361-788383 GAGAAGGGCAGGGTCGGCCTTGG + Exonic
1077102827 11:829750-829772 AGGAGGGGCAGCGCCGGGCGCGG + Intronic
1077178638 11:1202639-1202661 GACAGGGCCAGCGCAGGGCGGGG + Intergenic
1077194436 11:1272261-1272283 GAGAGGAGCAGGGCCGGTCCTGG - Intergenic
1077227910 11:1446370-1446392 GAGCTGGGCAGGGCTGGGCTGGG + Intronic
1077250973 11:1560517-1560539 GATAGGGGAAGCTCCAGGCTGGG + Intronic
1077326095 11:1964772-1964794 GAGAGGGGGAGGGCCGAGCCCGG + Intronic
1077341210 11:2027178-2027200 GAGACAGGCAGGGCCGGGGTGGG + Intergenic
1077342382 11:2031901-2031923 CAGAGGGGCAGGGATGGGCTGGG - Intergenic
1077505909 11:2929859-2929881 GAGAGCGGCAGGGCTGGACTTGG - Intergenic
1077506400 11:2931770-2931792 GAGAGGAGCTGGGCGGGGCTGGG - Intergenic
1078157360 11:8810495-8810517 GGTAAGGGCAGCTCCGGGCTGGG - Intronic
1078852637 11:15178509-15178531 AAGAGGGGCTGAGCCAGGCTTGG + Intronic
1079233459 11:18669952-18669974 GAGAGGGGAAGCGCTGGCTTAGG + Intergenic
1079654703 11:22973834-22973856 GAGAGGGGCAGCCACTGTCTTGG - Intergenic
1080668942 11:34358480-34358502 GAGAGGTGGAGCGCCTGGATGGG - Intergenic
1081198233 11:40186951-40186973 GAGAGTGGCAGGGCTGTGCTGGG + Intronic
1083331476 11:61900395-61900417 GAGAGGGGCACCCGCAGGCTGGG + Intronic
1083660017 11:64247559-64247581 GGGAGGGGCGGCGCCGGGAGCGG - Intergenic
1083944999 11:65918872-65918894 GGGAGGGGCAGGGCAGGGCCGGG - Intronic
1083994438 11:66265238-66265260 GAGTGGGGCGGGGCTGGGCTGGG + Intronic
1084000356 11:66292425-66292447 GTGAGCGGCTGGGCCGGGCTGGG - Intronic
1084062928 11:66687588-66687610 GAGAGAGGCAGACCCGGACTCGG - Exonic
1084151333 11:67289263-67289285 GGGCGGGGCTGCGCCGGGCCGGG - Intronic
1084307478 11:68296540-68296562 GAGAGGTGAAGCGCCTGGCCTGG - Intergenic
1084752592 11:71214077-71214099 GAGAGAGGCAGGGCCAGGCCAGG - Intronic
1085260907 11:75204153-75204175 GAGAGAGGCAGGGCCAGGCCAGG + Intronic
1085409782 11:76284242-76284264 GGGAGGGACAGGGCTGGGCTCGG - Intergenic
1085687642 11:78638803-78638825 GAGGGAGGCAGCTCCGGCCTTGG - Intergenic
1085778937 11:79391072-79391094 GTAAGTGGCAGAGCCGGGCTTGG - Intronic
1086759238 11:90606563-90606585 GAGAAGGGTAGCGCTGGGGTCGG - Intergenic
1086855696 11:91862472-91862494 GGGAGGGGTAGTGCAGGGCTGGG + Intergenic
1087182936 11:95157364-95157386 GAGATGTGCTGAGCCGGGCTGGG + Intergenic
1089558900 11:119333628-119333650 GAAAAGGGCAGGGCCGGGCTTGG + Intergenic
1090768262 11:129895614-129895636 GGGCGGGGCAGCGCGGGGCGGGG + Intergenic
1090832378 11:130428356-130428378 GAGAGCGGCCGGGCCGCGCTCGG - Exonic
1090909565 11:131106532-131106554 GAGAGGGGCAGGCTCTGGCTTGG + Intergenic
1202809075 11_KI270721v1_random:19951-19973 GAGAGGGGGAGGGCCGAGCCCGG + Intergenic
1202824195 11_KI270721v1_random:82367-82389 GAGACAGGCAGGGCCGGGGTGGG + Intergenic
1202825368 11_KI270721v1_random:87090-87112 CAGAGGGGCAGGGATGGGCTGGG - Intergenic
1094166636 12:27450107-27450129 GAGAGGAGCAGAGCTGAGCTGGG - Intergenic
1096597986 12:52709331-52709353 GAGAGCTGCAGCCCCGGTCTAGG + Intergenic
1096617240 12:52840410-52840432 GAGAGAGGCAGGGCTGGGCATGG + Intronic
1096647659 12:53047374-53047396 GTGAGTGGCCGCGCCGCGCTGGG + Intronic
1096783928 12:54006493-54006515 GAGAGGGACAGAGACGGCCTCGG + Intronic
1097189176 12:57211401-57211423 GGGAGGGGCAGGGCAGGGCTAGG - Intronic
1100327140 12:93550467-93550489 TACAGGGGCAGGGCAGGGCTAGG + Intergenic
1102119299 12:110428661-110428683 CAGAGGGGGAGCCCCAGGCTGGG + Intergenic
1102254390 12:111407234-111407256 GGGAGGGGCACGGCCAGGCTGGG + Intronic
1102613710 12:114134623-114134645 GAGAGGGGCAGGCAGGGGCTTGG - Intergenic
1103565364 12:121812550-121812572 GGGAGGGGCAGGGCCGGCCGGGG + Intronic
1103614034 12:122141086-122141108 GAGTGGGGCAGTGCCAGGGTGGG + Intronic
1103659238 12:122500556-122500578 GGCCGGGGCAGCGCCGGGCGAGG - Exonic
1103871700 12:124096956-124096978 GAGAGGGCCACGGCTGGGCTAGG + Intronic
1104017811 12:124972059-124972081 GTGAGGGGCAGCACCAGACTCGG - Intronic
1104665035 12:130641821-130641843 GAGCGTGGCTGCACCGGGCTGGG + Intronic
1104746512 12:131214259-131214281 CAGAGGGGCCGCGTTGGGCTGGG - Intergenic
1104874169 12:132021437-132021459 GTGAGAGGCAGCACCGGGCATGG - Intronic
1105472084 13:20703769-20703791 GCGCGGGCCGGCGCCGGGCTGGG + Intronic
1105723197 13:23135811-23135833 CAGAGGGGGAGCTCCAGGCTGGG - Intergenic
1105830597 13:24160655-24160677 GCGGGGGGAAGAGCCGGGCTGGG + Intronic
1108313883 13:49220093-49220115 GAGCGGAGCAGGGCCGGGCCGGG + Intergenic
1109075672 13:57832077-57832099 GAGAGGGGCAGGGAAGTGCTTGG + Intergenic
1110219705 13:73059662-73059684 GACAGGGGCCGCTCCAGGCTGGG + Intronic
1111176726 13:84605771-84605793 GAGAGTGGCAGTGGTGGGCTGGG + Intergenic
1111672501 13:91348162-91348184 GAGGGGGGCAGGGCCGGGGCGGG + Intergenic
1112489329 13:99847914-99847936 GGCAGGGGCAGCCCAGGGCTTGG - Intronic
1112771415 13:102798904-102798926 GAGAGGAGCAGCGCGGTTCTCGG - Exonic
1114674267 14:24430268-24430290 GAGAGGGGCAGCGGACGGCTGGG + Intronic
1118487121 14:66224723-66224745 GAGAGGGGCAGGGAAGTGCTGGG + Intergenic
1119386023 14:74258565-74258587 GAGAAGGGAACCGCCAGGCTTGG + Intronic
1119554370 14:75542059-75542081 GGGAGGCGCAGAGCAGGGCTTGG - Intronic
1121009201 14:90510008-90510030 CAGAGAGGCAGGGCGGGGCTGGG + Intergenic
1122204031 14:100139433-100139455 GAGAGGGCCAGGGCCTGGCGAGG + Intronic
1122310707 14:100792362-100792384 GAGAGGGGCAGGGTGGGGCCGGG - Intergenic
1122609697 14:102973557-102973579 GAGAAGGGGAGGGCCTGGCTCGG + Intronic
1122636457 14:103131982-103132004 GAGAGGGGCCGCCTGGGGCTGGG + Intronic
1122960947 14:105093413-105093435 GACGGGGGCAGCGCGGGGCGGGG + Intergenic
1122984020 14:105203932-105203954 GAGTGAGGCAGCGCCAGGCTGGG - Intergenic
1123051602 14:105546826-105546848 GACAGGGTCAGCGCCGGCCTCGG + Intergenic
1123077014 14:105672529-105672551 GACAGGGTCAGCGCCGGCCTCGG + Intergenic
1124637939 15:31376844-31376866 GAGAGAGGCAGGGCAGGGCCAGG - Exonic
1125674098 15:41493600-41493622 GGGAGGGGCCGCTCCGCGCTGGG - Intronic
1125859730 15:42987188-42987210 GGCAGGGGCAGAGCCGGGATGGG + Intronic
1125921676 15:43528900-43528922 GAGGGGGGCGGCGCCGGGTAGGG + Exonic
1128199425 15:65792133-65792155 GAAGGGCGGAGCGCCGGGCTGGG - Intronic
1128733063 15:70033985-70034007 GAGATGGGCTGCCTCGGGCTGGG + Intergenic
1128780089 15:70353580-70353602 GAGCTAGGCAGCCCCGGGCTGGG + Intergenic
1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG + Intergenic
1130627086 15:85526709-85526731 GCCAGGGGCAGGGCCAGGCTGGG - Intronic
1130859527 15:87874267-87874289 GAGAGGGGCAGAGCAGGGAAGGG - Intronic
1131824287 15:96305585-96305607 GAGACTGGCAGGGCCGGGCGCGG + Intergenic
1132092124 15:98955525-98955547 GAGGCGGGCAGCCCCGGGTTAGG + Intronic
1132402664 15:101522991-101523013 GAGAGGAGCAAGGCAGGGCTGGG + Intronic
1132563599 16:610305-610327 CTGAGAGGCAGCGCCTGGCTGGG + Intronic
1132648655 16:1010547-1010569 GGCAGAGGCAGCGGCGGGCTCGG + Intergenic
1132672511 16:1107623-1107645 GAGTGGGGCAGCACCGGCCTGGG + Intergenic
1132779423 16:1614476-1614498 GGCAGGGGCCGCGGCGGGCTCGG + Intronic
1132842404 16:1984500-1984522 GACAGGGGCTGCGCGGGGCTGGG - Intronic
1133216211 16:4294048-4294070 GAGAGGGGCAGGGCTGGGAAAGG + Intergenic
1133315383 16:4880377-4880399 TAGAGGGGCAGCTCTAGGCTGGG + Exonic
1133758363 16:8779218-8779240 GAGAGGGACAGAGCTGGGCTTGG + Intronic
1133771093 16:8867650-8867672 AAGAGGCGCAGAGCCCGGCTGGG - Intronic
1134275344 16:12770889-12770911 GGGAGGGGCGGGGCGGGGCTGGG + Intronic
1134615782 16:15650299-15650321 GTGAGGCGCTGCGCGGGGCTGGG + Intronic
1135968212 16:27052876-27052898 GAGAGGGGGAGCAACTGGCTGGG - Intergenic
1136514376 16:30759149-30759171 GAGAGTGCCAGGGCAGGGCTGGG - Exonic
1136550476 16:30979974-30979996 GAGGGCGGCGGCGCCGGGCGTGG - Exonic
1138556385 16:57773321-57773343 GTGAGGGGCTGTGCAGGGCTTGG + Intronic
1138658335 16:58503309-58503331 GCCAGGGGCAGTGCCGGGGTCGG + Intronic
1139017785 16:62711335-62711357 GAGAGGGGCAGGGAAGTGCTGGG + Intergenic
1139441547 16:66970397-66970419 AAGAGTTGCAGCGCCGGGCGCGG - Intronic
1139446438 16:67001205-67001227 TAGAGGGGCAAGGCTGGGCTGGG + Intronic
1139545373 16:67647390-67647412 GAGGGGGACAGGGCAGGGCTTGG + Intronic
1139847219 16:69929547-69929569 GAGGGGGGCCGGGCTGGGCTGGG + Intronic
1140188794 16:72796986-72797008 GAGAGGGACAGCGCCGAGGGGGG - Exonic
1141646397 16:85370240-85370262 GGGAGGGGCAGAGCCTGGCTGGG - Intergenic
1141703433 16:85652608-85652630 GAGAGGGGAGGCGCCGGCCCGGG + Intronic
1142030513 16:87836173-87836195 GGGCGGGGCAGAGCCGGGCCTGG - Intronic
1142205416 16:88780457-88780479 GAGAGGGGCAGGGGTTGGCTGGG + Intronic
1142227657 16:88885425-88885447 GAGAGTGGGGGCGCCGGGCTGGG - Intronic
1142252044 16:88996472-88996494 GAAAGGGGCAGCCCCTGGCGTGG + Intergenic
1142395240 16:89828299-89828321 GTGAGGGGCAGGGCGGGGCGCGG - Intronic
1142764221 17:2056593-2056615 GAGGGGAGAAGTGCCGGGCTGGG + Intronic
1143372568 17:6449507-6449529 GAGAGGGGCAGAGACTGGCCAGG - Intronic
1143515213 17:7416116-7416138 CAGAGGGGCTGGGCGGGGCTGGG + Intronic
1144269025 17:13600506-13600528 GAGCGGGGCGGGCCCGGGCTGGG - Intronic
1146219867 17:31008804-31008826 GTGAGGGGGAGCGCCGGGCCGGG + Intergenic
1147265422 17:39231664-39231686 GGGAGGGGCAGCCAAGGGCTAGG - Intergenic
1147377676 17:40032613-40032635 GGGAGGGGCAGAGCCAGTCTAGG - Intronic
1147454257 17:40526345-40526367 GAGGGGGGCAGATCTGGGCTGGG - Intergenic
1147460474 17:40565092-40565114 GAGAGTGGCGGGGCTGGGCTTGG - Intronic
1148198074 17:45729025-45729047 GAAAGGGTGAGCGCTGGGCTAGG + Intergenic
1148241752 17:46003753-46003775 GTGGGGGGCAGAGCCAGGCTGGG + Intronic
1148682941 17:49485174-49485196 GGGAGGGGCAGCGACGGGGCGGG - Intergenic
1148775898 17:50095602-50095624 GGGAGGGGCAGCCGGGGGCTAGG + Intronic
1148896686 17:50843034-50843056 GAGATGGGCTGGGCCAGGCTAGG - Intergenic
1149657581 17:58318382-58318404 GAGAGTGGCAGGGGCAGGCTCGG + Exonic
1150005020 17:61463921-61463943 GAGAGAGGCAGGGCCGGGAAAGG + Intronic
1151322480 17:73360164-73360186 GTGAGAGGCAGCGCGGGGCGGGG + Intronic
1151493217 17:74444666-74444688 GAGAGGGGAGGCGCTGGGATTGG - Intronic
1151947026 17:77325414-77325436 GAGTGGGGAAGTCCCGGGCTGGG + Intronic
1152241244 17:79162392-79162414 GAGAGAGGCAGGGCTGGGCGCGG - Intronic
1152407741 17:80107322-80107344 AAGAGGCGCACCGCCTGGCTGGG - Intergenic
1152584050 17:81181344-81181366 GCGGGGGGCCGCGCCGGGCGGGG - Intergenic
1152693988 17:81734700-81734722 CAGAGGGGCTGGGCTGGGCTGGG + Intergenic
1152789748 17:82272906-82272928 GGGAGGGGCAGGGCGGGGGTGGG - Intronic
1153263748 18:3247856-3247878 GATAGCGGCAGCGAGGGGCTCGG + Exonic
1153855091 18:9137219-9137241 GGGAGGGGCGGCGGCGGGCGGGG - Intronic
1154021538 18:10668021-10668043 GTGAGGGGCTGCGCAGGGCTAGG + Intronic
1154290416 18:13101845-13101867 GAGAGGGGCATGGGCGGGCTGGG - Intronic
1155344195 18:24842606-24842628 GGGAGGGAGAGCCCCGGGCTCGG + Intergenic
1156179070 18:34581910-34581932 AATAGGGGCAGGGCCGGGCATGG - Intronic
1157814618 18:50721814-50721836 CAGTGGGGCAGCACTGGGCTGGG - Intronic
1158076470 18:53536195-53536217 GAGAGAAGCAGGGCCGGGCGCGG + Intergenic
1159111957 18:64069711-64069733 GGGAGGGCCAGAGCTGGGCTGGG + Intergenic
1159379461 18:67637402-67637424 GAGAGGGGCAGGGAAGAGCTGGG - Intergenic
1159997889 18:74984222-74984244 GTGAGGGGCAGCGCAGGCTTAGG - Intronic
1160684108 19:425453-425475 GAGTGGGGCAGCGTGCGGCTGGG + Intronic
1160687048 19:441950-441972 GAGAGGGGCAGAGCCTGGGCCGG - Intronic
1160738166 19:674200-674222 GAGAGGGGCAGAGCCGGGAGAGG + Intergenic
1160805891 19:992017-992039 AAGTGGGGCAGCGGCAGGCTGGG - Exonic
1160862209 19:1242148-1242170 GACGAGGGCAGCGCAGGGCTCGG - Intronic
1160917438 19:1503952-1503974 GAGAGGGGCTGCACCTGGCCTGG + Intergenic
1160972583 19:1776052-1776074 GAGAGGGGCAGCTCAGTTCTCGG - Exonic
1161144803 19:2671165-2671187 GAGAGGGGCAGCTCCTGGCATGG - Intronic
1161210200 19:3061996-3062018 GAGGGGGGTCGCGCCGGGCTGGG + Intronic
1161260987 19:3337606-3337628 GTGAGGGCCAGGGCCAGGCTCGG - Intergenic
1161343064 19:3753185-3753207 GGGAGGGGCAGCCCTGGGCTGGG + Intronic
1161354838 19:3813318-3813340 GTGAGGGGCCGGGCCAGGCTAGG - Intronic
1161678600 19:5667451-5667473 GTGAGGAGCAGCTCTGGGCTGGG + Intronic
1162340937 19:10091391-10091413 GGGAGGGGCAGGGCTGGGGTAGG - Intronic
1163496412 19:17648684-17648706 GACAGGGACAGCGCCAGGTTAGG - Intronic
1163748459 19:19061628-19061650 TAGAGAGGCAGCCCCAGGCTGGG + Intergenic
1163768676 19:19177842-19177864 GAGAAGAGCAGAGCCCGGCTTGG - Intronic
1163822014 19:19501379-19501401 GTGTGGGGCAGCGGTGGGCTCGG - Exonic
1165411553 19:35665546-35665568 GAGAGGGGGCACACCGGGCTTGG - Intergenic
1165428156 19:35756815-35756837 GCGACGGGCAGCGCCACGCTGGG + Exonic
1165946392 19:39445460-39445482 GAGAGAGGCAGGGCTGGCCTGGG - Exonic
1166092925 19:40521937-40521959 GAGTGGGTCAGGGCCGGGCATGG - Intronic
1166103971 19:40588687-40588709 GAGTGGGGTGGAGCCGGGCTGGG - Exonic
1166105337 19:40595415-40595437 GTCAGGGGCAGAGCCTGGCTGGG - Intronic
1166117349 19:40663886-40663908 GAGAGGGGCAGAAACGGCCTAGG - Intergenic
1166357017 19:42233263-42233285 GTGAGGGGCGGGGCTGGGCTGGG - Intronic
1166667408 19:44689416-44689438 GAAAGGGGCAGAGACGGGGTGGG - Intergenic
1166751915 19:45168291-45168313 GACAGGGTCAGGGCCGGGCGCGG - Intronic
1167466044 19:49651596-49651618 AAGAGGGACAGCGCCAGCCTGGG - Exonic
1167471770 19:49679617-49679639 GAGAGGGGCAGCGTGGGGGTGGG + Intronic
1167641903 19:50686923-50686945 GAGAGGGGCAGTGAGGGGCCGGG + Intronic
924969193 2:108801-108823 GAGAGAGGCAAAGCTGGGCTGGG + Intergenic
925034780 2:676988-677010 GGGAGGGGCGGGGCCGGGCGGGG - Intronic
925230381 2:2227554-2227576 GACAGGAGCAGTGCAGGGCTGGG - Intronic
925984742 2:9206752-9206774 GAGAGGGGCGGGTCCGGGCCGGG - Exonic
926914196 2:17877773-17877795 GGGAGGGGGAGCGCGGGGGTGGG + Intergenic
927552432 2:24011144-24011166 GGGAGGGGCGGCTCCGGGCGAGG - Intronic
927553752 2:24018650-24018672 CAGAGGGGGAGCCCCAGGCTGGG - Intronic
927785907 2:25974734-25974756 TAGAGGGGCAGGGCTGGGCATGG + Intronic
927885545 2:26716049-26716071 GAGAGGGGCAGCGTCTTGCCTGG + Intronic
929174276 2:38960733-38960755 GAGAGGAGCGGGGCCGGGCCAGG + Intronic
929174277 2:38960738-38960760 GAGCGGGGCCGGGCCAGGCTAGG + Intronic
929941314 2:46336095-46336117 GAGAGGAGCAAGGCTGGGCTGGG + Intronic
932322646 2:70833514-70833536 AAGAGGGGCAGCCATGGGCTAGG - Intronic
932583617 2:73008559-73008581 GGGAGAGGCAGGGCCCGGCTTGG - Intronic
932721884 2:74144638-74144660 GAGAAGGACAGCGCTTGGCTGGG + Intronic
932757138 2:74416869-74416891 CAGAGGGGGAGCCCCAGGCTGGG + Intronic
932795968 2:74696486-74696508 AAGAGAGGCAGGGCCGGGCGCGG - Intergenic
933753211 2:85616466-85616488 GCGCGGGGCCGGGCCGGGCTAGG + Intronic
934079187 2:88452725-88452747 AGGAGGAGCCGCGCCGGGCTCGG - Intergenic
934556520 2:95289610-95289632 GAGAGGGGCAGGGGGAGGCTTGG - Exonic
934715341 2:96539711-96539733 GAGAGGGGGAGGGCCGGGAAGGG - Intronic
935250118 2:101253319-101253341 GTGAGGCGCTGCGCCGCGCTAGG - Exonic
937209940 2:120262007-120262029 GAGAGGGGCCGAGCTTGGCTGGG + Intronic
937854430 2:126662079-126662101 AAGAGTGGCAGTGCTGGGCTGGG - Intronic
940848433 2:158665184-158665206 GAGACGGGCTGGGCTGGGCTGGG + Intronic
941129252 2:161625860-161625882 GACAGGGGCAGTGTCGGGGTAGG + Intronic
944306803 2:198188491-198188513 GAGGGGGGCAGGGCAGTGCTGGG + Intronic
947741152 2:232485583-232485605 GAGAGGCGCGCCGGCGGGCTGGG - Intronic
947872669 2:233448224-233448246 TAGAGAGGCAGCTCCAGGCTGGG - Intronic
948046817 2:234951851-234951873 GAGAGGGGCGGGGCGGGGCGCGG - Intergenic
948124198 2:235552896-235552918 CAGAGAGGCAGCGCCTGCCTTGG + Intronic
948524316 2:238560761-238560783 CAGAGGGGCAGGGCTGGGCCAGG + Intergenic
948792346 2:240385561-240385583 GAGCCGGGCAGGGCTGGGCTGGG + Intergenic
948874041 2:240818062-240818084 CAGGGGGGCAGCACCCGGCTGGG + Intronic
1169082286 20:2804978-2805000 AGGAGGGGCAGGGCCGGGCTTGG - Intergenic
1169164195 20:3407968-3407990 CGGAGGGGCGGGGCCGGGCTGGG - Intergenic
1171347670 20:24478275-24478297 CAGAGTGGCAGCGCCAGGCAGGG + Intronic
1171373847 20:24678509-24678531 GAGACGGGCAGCGACGGAATGGG + Intergenic
1171409387 20:24935891-24935913 GGGAGGGACAGCACAGGGCTGGG - Intergenic
1172644570 20:36461669-36461691 GGGCGGGGCAGGGCCGGGCCGGG - Intronic
1172842264 20:37909099-37909121 CAGAGGGGAAGAGCAGGGCTGGG + Intronic
1173246915 20:41343256-41343278 GGGAGGGGCAGAGCCGGGGTTGG - Intronic
1173307246 20:41862347-41862369 TAGAGGGGCCACGCCAGGCTGGG + Intergenic
1173556758 20:43971931-43971953 GAGAGGGGCAGTGGATGGCTGGG + Intronic
1173620097 20:44430026-44430048 GAGAGGAGAAGCACCAGGCTAGG - Exonic
1173750280 20:45470561-45470583 GGGCGGGGCCGCGCTGGGCTGGG + Intronic
1173938297 20:46888088-46888110 GAGAGGGCCAGCGTGGAGCTGGG + Intergenic
1175750566 20:61494116-61494138 CAGTGGGGCCGAGCCGGGCTGGG + Intronic
1175859557 20:62143124-62143146 GAGAGGGCCGGGGCCGGGCGCGG - Intronic
1175898859 20:62352164-62352186 GGGAGGGGCAGTGCCGAGCGGGG - Intronic
1175926975 20:62475855-62475877 GAGCGGGGCCCCGCCGCGCTGGG + Intronic
1175931797 20:62497033-62497055 GGGAGGCGCAGCTGCGGGCTCGG + Intergenic
1175999243 20:62824748-62824770 GAGCGGGCCAGGGCTGGGCTGGG - Intronic
1176029883 20:63006801-63006823 GGCAGCGGCAGCGGCGGGCTCGG - Exonic
1176100227 20:63361362-63361384 GAGGCGGGCAGGGCCGGGCGGGG - Exonic
1176301561 21:5101348-5101370 GAGAGGGGCAGGGCAGGGGCAGG + Intergenic
1176301663 21:5101636-5101658 GAGAGGGGCAGGGCAGGGGCAGG + Intergenic
1176302308 21:5104504-5104526 GGGAGGGGCAGGGCAGGGCCCGG - Intergenic
1178948489 21:36966893-36966915 GCGAGGGGCAGCGCTGGGGCGGG + Intronic
1179437828 21:41374370-41374392 GCGAGGGGCAGGGCAGGACTAGG - Intronic
1179473873 21:41631094-41631116 GAGGGTGGCAGGGCCGGCCTGGG + Intergenic
1179727302 21:43347651-43347673 AACAGGGCCAGAGCCGGGCTGGG - Intergenic
1179854719 21:44157419-44157441 GGGAGGGGCAGGGCAGGGCCCGG + Intergenic
1179855368 21:44160263-44160285 GAGAGGGGCAGGGCAGGGGCAGG - Intergenic
1179855470 21:44160551-44160573 GAGAGGGGCAGGGCAGGGGCAGG - Intergenic
1180041372 21:45282067-45282089 GGGAGGGGCTGAGCTGGGCTGGG - Intronic
1180200524 21:46221136-46221158 GAGGTGGACAGCCCCGGGCTTGG + Intronic
1180200532 21:46221160-46221182 GAGGTGGACAGCCCCGGGCTTGG + Intronic
1180200540 21:46221184-46221206 GAGGTGGACAGCCCCGGGCTTGG + Intronic
1180955286 22:19738651-19738673 GGGAGGGGCAGCGCCGTGTCAGG + Intergenic
1180969739 22:19808992-19809014 GAGAGGGGCAGGGAAGTGCTAGG + Intronic
1181038548 22:20181430-20181452 GGGAGGGGCAGGGCAGGGCAGGG + Intergenic
1181040122 22:20188115-20188137 GACAGGGGCAGCTCAGGCCTGGG + Intergenic
1181317081 22:21977919-21977941 GGGAGGGACAGGGCAGGGCTGGG + Intronic
1182279588 22:29209982-29210004 GAGGGTGGCAGGGCCAGGCTGGG + Intronic
1182299123 22:29328289-29328311 CAGAGGGGCAGAGCTAGGCTGGG - Exonic
1182354100 22:29714477-29714499 GACAGGGGCAGGGCAGGGCAGGG + Intergenic
1183482872 22:38074678-38074700 GAGCGGGGAGGCCCCGGGCTGGG + Intronic
1184089233 22:42283687-42283709 GGCAGGGGCCGCGCCGGGCCAGG - Intronic
1184806614 22:46798750-46798772 CAGAGGTGCAACGCCTGGCTTGG + Intronic
1184850103 22:47115068-47115090 GAGAGGGGCACAGCTGGGATTGG + Intronic
1185121914 22:48976560-48976582 GAGAGGGGCAGCTCTGGGAGAGG + Intergenic
949502441 3:4693751-4693773 GAGAAGGGCACAGCCAGGCTGGG - Intronic
950464491 3:13145266-13145288 GACATGAGCAGCCCCGGGCTTGG + Intergenic
950464983 3:13148349-13148371 GAGGCGGGCTGTGCCGGGCTTGG - Intergenic
950533563 3:13566954-13566976 GAGAGGGCCAGGGCCGTGCCTGG + Intronic
950555655 3:13694423-13694445 GAGAGGTGCAGAGCAGGGCCAGG + Intergenic
950940125 3:16884204-16884226 GTAGGGGGCAGCGCCGAGCTCGG + Intronic
952990647 3:38828253-38828275 GAGAGGAGCAGCGCCAGAATGGG - Intergenic
953385264 3:42502594-42502616 AAGAGGCGCAGCTCAGGGCTGGG - Intronic
953694401 3:45146350-45146372 GAGCGCAGCTGCGCCGGGCTTGG - Exonic
954117722 3:48476431-48476453 GAGTGGGGCAGAGCTGGGGTGGG + Intronic
954146480 3:48636788-48636810 GAGAGTGGCTGTGCAGGGCTGGG - Exonic
954160054 3:48714679-48714701 GAAAGGGCCAGGGCCAGGCTTGG - Intronic
956487760 3:69740024-69740046 GGGAGGAGGAGCGCCGGGCCGGG + Intronic
957459750 3:80501244-80501266 GAAAGGGGCAGGGCAGGGTTTGG + Intergenic
959958396 3:112267284-112267306 GAGAGAGACAGGGCCGGGCGTGG + Intronic
960158112 3:114318373-114318395 GAGAAAGGCAGAGCCAGGCTAGG + Intergenic
961329210 3:126128938-126128960 GAAAGGGGCTGGGCTGGGCTGGG - Intronic
961505469 3:127368304-127368326 GACAATGGCAGGGCCGGGCTGGG - Intergenic
961657979 3:128453756-128453778 GTGCTGGGCAGCGCGGGGCTGGG - Intergenic
961674672 3:128557236-128557258 GTGAGGTGCAGCTCTGGGCTGGG + Intergenic
962221881 3:133571489-133571511 GAGAGGGAGAGGGCCGGGCATGG + Intergenic
962865025 3:139441390-139441412 GGGAGAGGCAGGGCAGGGCTGGG + Intergenic
962891362 3:139676004-139676026 GAGAAGGGAAGCTCCAGGCTTGG - Intronic
964394044 3:156226801-156226823 GAGAGGAGGAGTGCTGGGCTTGG - Intronic
964630146 3:158801710-158801732 GAGAAGGGCAGCGCGCGTCTTGG + Intronic
966147319 3:176826614-176826636 GAGAGAGGCAGAGGAGGGCTTGG - Intergenic
966318595 3:178676387-178676409 GAGAGGGACAGTGCAGGGCTGGG + Intronic
966911402 3:184562191-184562213 GAGCCGGGCCGCGCCGGGCCGGG - Exonic
967732403 3:192918107-192918129 GAGAGGGCCAGGGCAGGGCAGGG - Exonic
968063954 3:195747969-195747991 GGGCGGGGCGGGGCCGGGCTGGG - Intronic
968283658 3:197495555-197495577 GAGAGGATCAGCTCTGGGCTTGG - Intergenic
968487592 4:871333-871355 GTGAGGGCCAGCGCCTGCCTTGG - Intronic
968512890 4:1003177-1003199 GCGAGGGGCCGGGCCGGGCCGGG + Intronic
968729960 4:2264974-2264996 GGGAAGGGCAGGGCAGGGCTGGG - Intergenic
968736607 4:2300533-2300555 GAGAGGGGCTCCTCCTGGCTGGG + Intronic
968890034 4:3363903-3363925 GGGAAGGGCAGTGCCGGGATGGG + Intronic
969414972 4:7052208-7052230 GGCAGGGGCAGAGCCGGCCTTGG - Intronic
970432329 4:16000784-16000806 GAGAGGGGCAGCTCCAGGACAGG + Intronic
973137321 4:46724450-46724472 GAGATAGGAAGCGGCGGGCTCGG + Intergenic
977568796 4:98609368-98609390 GAGAGGGCCAGGGCAGTGCTCGG + Intronic
977654357 4:99504377-99504399 CAGAGGTGCAGTGCTGGGCTTGG - Intergenic
979674765 4:123398652-123398674 GGGAGGGGCCGCGCCGAGCGAGG - Intronic
979865168 4:125744948-125744970 GAGAGAGCCAGCTCCGGCCTCGG - Intergenic
985538480 5:477104-477126 GGGAGGGGCAGCAGCGGACTGGG - Intronic
985562904 5:600905-600927 GAGCTGGGCAGAGCCGGGCCTGG - Intergenic
985719730 5:1482636-1482658 GGGTGGGGCAGAGCCGGGGTGGG + Intronic
986594732 5:9409520-9409542 GGGAGGGGGAGCCCAGGGCTGGG - Intronic
988685822 5:33524414-33524436 GAGAGGGCCATCGCAGGGCCTGG - Exonic
990211139 5:53482141-53482163 GCGCGGGGTAGCTCCGGGCTGGG + Intronic
994301981 5:98157868-98157890 GAGTGGGGCAGGGCAGTGCTGGG - Intergenic
995140241 5:108727939-108727961 GAGAGCCGCAGCGCCAGGCCCGG + Intergenic
995342271 5:111073079-111073101 GAGCGGGGCTGCGCCTAGCTTGG + Intronic
995853428 5:116570513-116570535 GAGAGGGGCAGTGCAGAGATAGG + Intronic
996221384 5:120936890-120936912 GGGATGGGCAGGCCCGGGCTCGG + Intergenic
997206855 5:132055240-132055262 GAGAGGGGAAGGGCCGGCCTGGG - Intergenic
997598656 5:135124594-135124616 GTGAGGTGCAGCCTCGGGCTGGG + Intronic
999312666 5:150561835-150561857 GAAAAGGGCAGAGCCAGGCTCGG - Intergenic
1002080256 5:176733385-176733407 GAGAGGGGCTCCTCCGGCCTGGG - Intergenic
1002273345 5:178087136-178087158 GAGAGAGGAGGCGCCGGGCGCGG - Intergenic
1002291792 5:178205191-178205213 GCGAGTGGCAGCGCCAGGCCCGG - Intronic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1005926720 6:30451275-30451297 GAGTTGGGCAGCGCCGGCCGGGG + Intergenic
1006167054 6:32071183-32071205 GAAAGGGGCACAGCTGGGCTGGG + Intronic
1006806387 6:36792296-36792318 GGGTGGGGCAGCTCCAGGCTCGG - Intronic
1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG + Intergenic
1007176526 6:39901473-39901495 GTGAGGGGCAGTGCCAGGCCTGG + Intronic
1007356355 6:41320648-41320670 GAGAGGCTCATCGCCTGGCTTGG - Intergenic
1007937071 6:45741900-45741922 GAGAGGCGCGGGGCGGGGCTGGG - Intergenic
1008027274 6:46652820-46652842 AGGAGGGGCAGGGCCGGGCTAGG + Intronic
1011517293 6:88167139-88167161 GGGAGGGGGCGCGCCGGGCCGGG - Intergenic
1014137730 6:117907900-117907922 GTGAGCGGCGGCGCCGGGCGAGG + Intronic
1015525823 6:134175032-134175054 GAGAGGGCGAGCCCCGGGCGGGG + Intronic
1017047948 6:150364806-150364828 GAGAGGGGCAGGGCAGGTCACGG - Intergenic
1018049652 6:159997627-159997649 GAGAGGGGCAGAGAGCGGCTAGG - Intronic
1018966899 6:168496712-168496734 GAGATGGGCAGGGAAGGGCTCGG - Intronic
1019213156 6:170422532-170422554 AAGAGGGTCAGGGCCGGGCGCGG + Intergenic
1019331236 7:461850-461872 AAGCGGGGCAGAGCCGGGGTCGG + Intergenic
1019341348 7:510466-510488 GGTAGGGGCGGCCCCGGGCTCGG + Intronic
1019341430 7:510681-510703 GGTAGGGGCGGCCCCGGGCTTGG + Intronic
1019513518 7:1429904-1429926 CAGAGGGGCTGCTCCTGGCTGGG - Intronic
1019599974 7:1876377-1876399 GAAAGGGGCAGCGTCCGGCAGGG - Intronic
1020080256 7:5282886-5282908 GGGAGGGGCGGGGCCGGGCGCGG + Intronic
1020181101 7:5923026-5923048 AAGAGGGCCAGGGCCGGGCGCGG + Intronic
1020238519 7:6374672-6374694 GAGATAGGAAGCGGCGGGCTCGG - Exonic
1020301832 7:6801862-6801884 AAGAGGGCCAGGGCCGGGCGCGG - Intronic
1021969350 7:25951359-25951381 TAGAGCGGCCGCGCGGGGCTGGG + Intergenic
1023000317 7:35801419-35801441 GGGCGCGGCAGCGGCGGGCTCGG + Intronic
1023290543 7:38664274-38664296 GAGAAGGGCAGGGCAGGGCAGGG + Intergenic
1023844572 7:44113499-44113521 CAGAGGGGGAGGGCGGGGCTGGG + Intronic
1023862514 7:44224954-44224976 GGGAGGGGCTGGGCAGGGCTGGG - Intronic
1024248064 7:47485392-47485414 GAGAGGGCCAGCGCCAGCCACGG + Intronic
1025710184 7:63901057-63901079 AGGAGGGGCAGGTCCGGGCTGGG + Intergenic
1026011000 7:66636001-66636023 GAGAGTGACAGCGCCAGGCAAGG + Intronic
1026016263 7:66673108-66673130 GAGAGTGACAGCGCCAGGCAAGG + Intronic
1026603112 7:71793012-71793034 GAGAGGAGCAGAGCCGGGTGCGG + Intronic
1026807684 7:73438129-73438151 GAGAGGGGCAGTGCAGGGTCAGG + Intergenic
1027151691 7:75738392-75738414 GAGAGTGGGGGCGCCGGGCTGGG - Intronic
1027151742 7:75738582-75738604 GAGAAGGGCAGAGGCGGGCTCGG - Intronic
1027336065 7:77151928-77151950 GAGAGGTGCAGAGGCTGGCTGGG - Intronic
1029298365 7:99559075-99559097 GAGGAGGGCAGCGCCGGGCAAGG + Intronic
1029779720 7:102719171-102719193 GAGAGGTGCAGAGGCTGGCTGGG + Intergenic
1029813984 7:103075237-103075259 CAGAGCCGCAGCGCCGGGCCAGG - Exonic
1029925240 7:104308876-104308898 GAGAGAGGAAGCGACGGGGTTGG - Intergenic
1030597951 7:111562129-111562151 GAGCGGGCCAGCTCCGGGCCAGG + Exonic
1032476425 7:132214410-132214432 GAGAGGCCCAGGGCTGGGCTGGG + Intronic
1032559375 7:132872813-132872835 AAGAGGGGGAGGGCCGGACTCGG + Intronic
1033247163 7:139727293-139727315 AAGAGTGGCAGAGCCTGGCTGGG + Intronic
1034349805 7:150408329-150408351 GAGAGGGGCAGCGCTGGCTTGGG + Intronic
1034485858 7:151361756-151361778 GGGAGGGGAGGGGCCGGGCTGGG + Intronic
1034499408 7:151440177-151440199 GGCAGGGGCAGCCGCGGGCTGGG - Intronic
1035476084 7:159145001-159145023 GATTGGGGCAGCGCGGGGCGGGG - Intergenic
1035706674 8:1680907-1680929 GACAGGGGCAGCGTAGGGCTGGG + Intronic
1036637768 8:10563772-10563794 CAGAGGGGCAGCGATGGGGTTGG - Intergenic
1037998901 8:23373828-23373850 GAGAGAGACAGTGCCAGGCTGGG - Intronic
1038266260 8:26041771-26041793 GAGAAGGGGAGCGGCGGCCTTGG + Intronic
1038734406 8:30156273-30156295 GGGAGGGGCGGAGCCGGGGTGGG - Intronic
1038807944 8:30812278-30812300 GAGTGCGGGAGCGCGGGGCTGGG - Intronic
1039062283 8:33581358-33581380 GAGAGGTGCAGCGCAGAGGTCGG - Intergenic
1042649505 8:71024037-71024059 GGGAGGGGCAGGGCCAGGCCAGG + Intergenic
1043527486 8:81112182-81112204 GAGCCGGGCGGGGCCGGGCTGGG + Intergenic
1045510018 8:102806713-102806735 GTGCGGGGCCGGGCCGGGCTGGG + Intergenic
1047926473 8:129687714-129687736 GTGAGTGGCAGAGCTGGGCTGGG - Intergenic
1049248503 8:141575770-141575792 GGGAGGGGCAGGGCAGGGCAGGG - Intergenic
1049290338 8:141798327-141798349 AAGAGGGGAAGAGCGGGGCTTGG + Intergenic
1049398033 8:142410964-142410986 GAGAGGGGCACTGCTGGGCAGGG - Intergenic
1049426124 8:142538630-142538652 GAGAAGGACAGCCCCAGGCTTGG + Intronic
1049501842 8:142971313-142971335 GTGAGGGGCAGCACCTGGATGGG + Intergenic
1049510447 8:143024451-143024473 GTGAGGGGCAGCGCCGGGACGGG - Intergenic
1049620838 8:143597745-143597767 GGGCGGGGCCGGGCCGGGCTAGG + Intronic
1049687263 8:143943981-143944003 GCGAGGGGGAGCGCCGGGACCGG + Intronic
1049716370 8:144094998-144095020 GCGCGGGGCGGGGCCGGGCTCGG - Intergenic
1051170659 9:14315625-14315647 GGGCGGGGCAGCGCCGCGGTGGG - Intronic
1052999223 9:34568344-34568366 GGGAGGGACAGCTCAGGGCTCGG - Intronic
1053519326 9:38762291-38762313 GAGAGGGGCTGGGTGGGGCTGGG + Intergenic
1055473940 9:76642889-76642911 GAGAGGGCCAAGGCAGGGCTGGG + Intronic
1055638257 9:78298146-78298168 GGGAGGGGAGGAGCCGGGCTGGG - Intronic
1057357084 9:94340730-94340752 GGGAGGGGCAGGGCTGGGCCTGG - Intergenic
1057557623 9:96100323-96100345 GAGAGGGCCAGCGAAGGCCTGGG + Intergenic
1057650668 9:96916897-96916919 GGGAGGGGCAGGGCTGGGCCTGG + Intronic
1057704491 9:97387580-97387602 GGGAGGGGCAGGGCGGGGCCAGG - Intergenic
1058967119 9:110048710-110048732 GCGAGCGGCAGCCCCGGGCTGGG - Exonic
1060182785 9:121545735-121545757 CTGAGGCGCAGCGCTGGGCTGGG + Intergenic
1060301751 9:122378131-122378153 GAGAGGGGCAGAACCAGGCAAGG - Intronic
1060406051 9:123373617-123373639 GCCAGGGGCCGCGCCGGGCCGGG - Exonic
1060514428 9:124257264-124257286 GAGAGCGGCCGCTCCTGGCTGGG - Intergenic
1060887809 9:127167971-127167993 GAGAAGGGCAGAGCTGGGTTGGG - Intronic
1060973782 9:127753564-127753586 GAGAGGCCCAGGGCTGGGCTAGG + Intronic
1061124149 9:128663203-128663225 CAGAGGGGGAGCCCCAGGCTGGG + Intergenic
1061227275 9:129288065-129288087 GAGAGGGGCAGACCTGGCCTCGG + Intergenic
1061321827 9:129835640-129835662 GAGAGGGGCGGCGGCGGCCGGGG - Intronic
1061519917 9:131111892-131111914 GAGAGGGGCAGGGCCAGGACCGG - Intronic
1061542061 9:131282904-131282926 CAGAGGGGCGGCGTCGGGGTGGG - Intergenic
1061860300 9:133464502-133464524 GAGAGTGCCTGCCCCGGGCTTGG + Intronic
1061883058 9:133577621-133577643 GAGAGGGGCTGCCCCGGCCCTGG + Intergenic
1061975702 9:134067337-134067359 GCGGGGGGCAAGGCCGGGCTCGG - Intronic
1062230473 9:135479474-135479496 GAGGCGGGCAGCACGGGGCTCGG + Intronic
1062272103 9:135714380-135714402 GGGACCGGCTGCGCCGGGCTGGG - Intronic
1062390125 9:136330532-136330554 GTGAGGCGCAGGACCGGGCTGGG - Intronic
1062527689 9:136984954-136984976 GAGAGGGGCAGGGAGGGGCCGGG - Exonic
1062677005 9:137752595-137752617 CAGAGTTGCAGCGCAGGGCTGGG + Intronic
1062695371 9:137873197-137873219 GGGAGGGGCTGCACCGTGCTTGG + Intergenic
1187507282 X:19887782-19887804 GAGAGGGGCGGGGCCGGGGCCGG + Intergenic
1188535195 X:31189319-31189341 GAGTGGGGCTGCGGCGGGCCAGG - Intronic
1194977659 X:100410108-100410130 CCAAGGGCCAGCGCCGGGCTAGG + Exonic
1195668202 X:107449354-107449376 AAGTGAGGCAGCGCCAGGCTGGG + Intergenic
1195688274 X:107604164-107604186 GAGCTGGGCTGGGCCGGGCTAGG - Exonic
1195954830 X:110317946-110317968 GAGAGAGCCAGTGCCGAGCTGGG - Exonic
1196085811 X:111681453-111681475 GAGAAGGGCCCCGCCGGGCGTGG - Intronic
1197152513 X:123235243-123235265 GGGAGGGGCAGGGCAGGACTGGG + Intronic
1197897724 X:131333279-131333301 GAGAAGGGTAGTGCGGGGCTGGG - Intronic
1198519880 X:137441877-137441899 GAGACCGGAAGCGGCGGGCTCGG + Intergenic
1199437492 X:147828882-147828904 GAGAGAGCCAGCTCCGGCCTCGG + Intergenic
1199600877 X:149540467-149540489 GTGTGGGGCAGGGCCGGGCGGGG - Intronic
1200216886 X:154371895-154371917 GAGAGCGGCAGCCCCGGACCAGG + Intronic
1200229171 X:154435601-154435623 GACAGGGGCAGCGCAGGGACAGG - Intronic