ID: 1064213534

View in Genome Browser
Species Human (GRCh38)
Location 10:13380953-13380975
Sequence ACAGAATTTTTGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064213529_1064213534 -3 Left 1064213529 10:13380933-13380955 CCCCACTGTGAAGGTAAAGAACA No data
Right 1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG No data
1064213527_1064213534 6 Left 1064213527 10:13380924-13380946 CCAAGGGGTCCCCACTGTGAAGG No data
Right 1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG No data
1064213530_1064213534 -4 Left 1064213530 10:13380934-13380956 CCCACTGTGAAGGTAAAGAACAG No data
Right 1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG No data
1064213531_1064213534 -5 Left 1064213531 10:13380935-13380957 CCACTGTGAAGGTAAAGAACAGA No data
Right 1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064213534 Original CRISPR ACAGAATTTTTGGCCAGGTG TGG Intergenic
No off target data available for this crispr