ID: 1064216940

View in Genome Browser
Species Human (GRCh38)
Location 10:13408466-13408488
Sequence AAGGCTGCCCAGTGGTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064216938_1064216940 -5 Left 1064216938 10:13408448-13408470 CCTACATTTGTACATGTGAAGGC No data
Right 1064216940 10:13408466-13408488 AAGGCTGCCCAGTGGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064216940 Original CRISPR AAGGCTGCCCAGTGGTTCCT TGG Intergenic
No off target data available for this crispr