ID: 1064218822

View in Genome Browser
Species Human (GRCh38)
Location 10:13422057-13422079
Sequence TTGGTTCTGCAGAAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064218822_1064218824 -7 Left 1064218822 10:13422057-13422079 CCTCCTGGCTTCTGCAGAACCAA No data
Right 1064218824 10:13422073-13422095 GAACCAAACAAACCATCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064218822 Original CRISPR TTGGTTCTGCAGAAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr